ID: 1184398879

View in Genome Browser
Species Human (GRCh38)
Location 22:44262093-44262115
Sequence CTGTGTCAGCGGCGAGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184398873_1184398879 10 Left 1184398873 22:44262060-44262082 CCAGGACCCTGAAACAAGAGCAG 0: 1
1: 0
2: 4
3: 22
4: 230
Right 1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 66
1184398875_1184398879 3 Left 1184398875 22:44262067-44262089 CCTGAAACAAGAGCAGCAGACCC 0: 1
1: 1
2: 1
3: 14
4: 191
Right 1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 66
1184398872_1184398879 15 Left 1184398872 22:44262055-44262077 CCACACCAGGACCCTGAAACAAG No data
Right 1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 66
1184398874_1184398879 4 Left 1184398874 22:44262066-44262088 CCCTGAAACAAGAGCAGCAGACC 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG 0: 1
1: 0
2: 0
3: 0
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184398879 Original CRISPR CTGTGTCAGCGGCGAGTGTC TGG Intronic
900540006 1:3197839-3197861 CTGGGTCAGGGACGAGGGTCAGG + Intronic
906036562 1:42754131-42754153 ATGGGTCAGAGGCCAGTGTCTGG + Intronic
908954203 1:69601199-69601221 CTTTGTCAGCGGAGAGGGCCTGG - Intronic
923089500 1:230729090-230729112 CTGGGTCAGGGGAGAGGGTCAGG - Intergenic
1065725849 10:28667367-28667389 CTGTGGCTGCGGCGGGTGGCAGG - Intergenic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG + Intergenic
1071504453 10:86224169-86224191 CTGTGTATGCTGGGAGTGTCGGG - Intronic
1074814633 10:117134817-117134839 CTGTGTAAGCGGCGCCTGCCTGG - Intronic
1075674929 10:124289780-124289802 CTGTGACCGCTGCCAGTGTCCGG + Intergenic
1076775075 10:132690867-132690889 TTGTGTCAGCGGAGCGTCTCAGG - Intronic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1083882996 11:65557716-65557738 CTGTCTCAAGGGCCAGTGTCGGG - Exonic
1091298473 11:134489737-134489759 CTGTGTCACCTGAGATTGTCAGG - Intergenic
1097363137 12:58680154-58680176 CTGTGTCACCGGAGAGAGTGGGG + Intronic
1101518554 12:105460204-105460226 CTGTGTCTGCGGCGGGGGTGGGG + Intergenic
1108727583 13:53200050-53200072 CTGTGGCTGCTGCTAGTGTCAGG + Intergenic
1129266419 15:74395817-74395839 CTGAGTCAGCAGCCAGGGTCGGG + Intergenic
1129521990 15:76191923-76191945 CTGAATCAGCGGCGAGGGGCCGG - Intronic
1132466552 16:80029-80051 CTGTGGCTGTGGCCAGTGTCGGG + Intronic
1134402215 16:13920483-13920505 CTGTGTCATCGCGTAGTGTCAGG - Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1137271000 16:46902073-46902095 GTGTGTCTGATGCGAGTGTCTGG + Intronic
1146793294 17:35764905-35764927 CTGTGTGAGCGGACAGAGTCAGG - Exonic
1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG + Intergenic
1163579814 19:18131761-18131783 CTATCTCAGCGGGGAGGGTCGGG - Intronic
1163818552 19:19482977-19482999 CTGTGACAGGGGCCAGTCTCGGG - Intronic
1167390248 19:49190200-49190222 CTGTGTCAGCAGAGACTGTGGGG - Exonic
930219986 2:48736421-48736443 CTGTGTCAGAGTCCAGTGACAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934556329 2:95288871-95288893 CTGTGTCAGGGCTGAGGGTCTGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
948784491 2:240345187-240345209 CTGTGTCACCGGTGCATGTCAGG + Intergenic
1180054236 21:45348922-45348944 CTGTGTCTGGGGCCTGTGTCTGG + Intergenic
1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG + Intronic
959157182 3:102681009-102681031 CTGTGTCAGCAGCTAGTGCGTGG - Intergenic
984821896 4:183889495-183889517 CTGTGTAAGCTGCCAGTGTGTGG + Intronic
998017664 5:138745515-138745537 CTGTGTCAGAGAAGAGTATCGGG + Intronic
999547837 5:152650491-152650513 CTGTTTCAGAGGGGAGGGTCAGG + Intergenic
1001778073 5:174344065-174344087 ATGTTTCAGCAGTGAGTGTCTGG - Intergenic
1003996396 6:11545165-11545187 CTGTGTCAGCAGCAAATGTAGGG + Intronic
1012842799 6:104351266-104351288 CTGTTTCAGAAGCGAGTGTGAGG + Intergenic
1018939706 6:168301122-168301144 CTGTGACAGCGGCCAGCGACCGG + Intronic
1021384805 7:20016107-20016129 CTGTGTCAGTTGTGAATGTCTGG + Intergenic
1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG + Intronic
1026844181 7:73688421-73688443 CTGTGTCAGCTTTGTGTGTCTGG + Intronic
1028331898 7:89605206-89605228 CTGTGTCAGCTGAGAGTGCTCGG + Intergenic
1035018735 7:155788098-155788120 CCGTGGGAGCCGCGAGTGTCTGG + Intergenic
1035388423 7:158489723-158489745 CTGTGTGAACGGTGAGTGTGGGG - Exonic
1049335500 8:142082428-142082450 TTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335529 8:142082588-142082610 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049335599 8:142082976-142082998 GTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335602 8:142082989-142083011 GTGTGTCTGGGGCGTGTGTCTGG - Intergenic
1049335625 8:142083118-142083140 CTGTGTCTGGGGTGTGTGTCTGG - Intergenic
1049351102 8:142165262-142165284 CTGTGACAGCTGGGAGTGCCCGG + Intergenic
1054252821 9:62736247-62736269 CTGTGAGAGAGGGGAGTGTCAGG - Intergenic
1054566937 9:66770746-66770768 CTGTGAGAGAGGGGAGTGTCAGG - Intergenic
1061722433 9:132560919-132560941 ATGTGTCAGCAGGGAGGGTCGGG + Intronic
1061726819 9:132586713-132586735 CTGTGTAGGTAGCGAGTGTCGGG + Intronic
1062544288 9:137054647-137054669 CTGGGTCAGCTGCGTGTCTCTGG - Intergenic
1195066393 X:101241977-101241999 CAGTGTCTGGGGAGAGTGTCAGG - Intronic