ID: 1184401456

View in Genome Browser
Species Human (GRCh38)
Location 22:44276975-44276997
Sequence GGAGGGGCTGAGGGGAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 2, 1: 1, 2: 8, 3: 80, 4: 830}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184401456_1184401472 16 Left 1184401456 22:44276975-44276997 CCCCAGTTCCCCTCAGCCCCTCC 0: 2
1: 1
2: 8
3: 80
4: 830
Right 1184401472 22:44277014-44277036 CCTAAGCTGCTCTCTCTGCCGGG 0: 1
1: 0
2: 10
3: 74
4: 518
1184401456_1184401470 15 Left 1184401456 22:44276975-44276997 CCCCAGTTCCCCTCAGCCCCTCC 0: 2
1: 1
2: 8
3: 80
4: 830
Right 1184401470 22:44277013-44277035 GCCTAAGCTGCTCTCTCTGCCGG 0: 1
1: 0
2: 3
3: 25
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184401456 Original CRISPR GGAGGGGCTGAGGGGAACTG GGG (reversed) Intronic
900088219 1:908662-908684 GGAGGGGATGAGGGGAAGGTGGG + Intergenic
900192308 1:1356630-1356652 GGAGGGGCTGAGGGGGAGTGGGG + Intronic
900345877 1:2210035-2210057 GGGGGTCCTGAGGGGAGCTGGGG + Intronic
900401281 1:2473946-2473968 GGAGGGGCCGAGGCGGCCTGGGG + Intronic
900437609 1:2639032-2639054 GGAGGGGCTTGGGAGAACTCTGG + Intronic
900625805 1:3608020-3608042 GGCGGGGGTGAGGGGAGTTGGGG + Intronic
900918128 1:5652547-5652569 TGAGGAGCTGCGGGGACCTGAGG - Intergenic
900951081 1:5858606-5858628 TGAGGGTCTGAGGGGAGCAGGGG - Intergenic
901052016 1:6430015-6430037 GGAGGGGCAGCTGGGAATTGGGG + Intronic
901130267 1:6958177-6958199 GGAGGGGCCTAGGGGAAAGGTGG - Intronic
901409422 1:9072027-9072049 GGTGAGGCTGAGGGGGACTCGGG - Intronic
901409436 1:9072070-9072092 GGCGAGGCTGAGGGGGACTCTGG - Intronic
901843986 1:11970918-11970940 GGAGGGGCCGAGGTGGAGTGAGG + Intronic
902388454 1:16089098-16089120 CGAGTCGCTGAGGGGAACTGAGG - Intergenic
902535820 1:17118897-17118919 GGTGGGTCCGAGGGGAAGTGAGG + Intronic
902659860 1:17893445-17893467 GGAGGGGATGAGGAGAAAAGGGG - Intergenic
903154656 1:21435732-21435754 GGAGGGGGTGAGGGGAAGCTGGG - Intergenic
903445279 1:23418907-23418929 GGAGGGACTGAGGGGGACACAGG - Intronic
903695071 1:25200441-25200463 GGCAGGGCTGAGAGGAAGTGTGG + Intergenic
903928670 1:26849716-26849738 GGAGGGGCTGAGCTGCAATGGGG - Intronic
904002726 1:27347991-27348013 GGAGAGGCTCAGGGAGACTGAGG + Exonic
904005275 1:27360352-27360374 GCAGGGGCTGAGAGAACCTGAGG + Exonic
904421724 1:30398462-30398484 GAGGGGGCTGAGGTGACCTGGGG + Intergenic
904467069 1:30714435-30714457 TGAGGGGCTTAAGGGACCTGAGG + Intronic
904495064 1:30881915-30881937 GCAGGGGGTGAGGGCAGCTGCGG - Intronic
904564886 1:31422857-31422879 GGAAGGGCTGACCGCAACTGGGG + Intronic
904639415 1:31912632-31912654 GGAGTGGAGGAGGGGGACTGGGG + Intronic
904838528 1:33355082-33355104 GGAGAGACTGAGGCGAGCTGGGG + Exonic
904999631 1:34658078-34658100 GGAGGGACTGAGGGACAATGTGG + Intergenic
905401678 1:37708235-37708257 GGAGGGGCTCAGGCTGACTGTGG + Intronic
905928191 1:41767025-41767047 TCTGGGGCTGAGTGGAACTGTGG - Intronic
906210843 1:44011427-44011449 GGCAGGGCTGGGGGGAAATGGGG + Intronic
906509152 1:46401052-46401074 GGAGGGGAGGAGGGGAAATTGGG + Intronic
906588509 1:47001754-47001776 GGAGGGTCTGAGCTGGACTGTGG - Intergenic
909070039 1:70983122-70983144 AGAGAGCCTGAAGGGAACTGTGG + Intronic
909197732 1:72648673-72648695 GGGGAGGCTGAGGGGAGTTGAGG + Intergenic
909433454 1:75615699-75615721 GGAGGGGGTGGGGGAAACCGCGG - Intergenic
909610814 1:77550063-77550085 GGAGAGGCTGAGGTGAACGATGG - Intronic
909782356 1:79562033-79562055 GGAGGTGCTGAGAGCAAGTGAGG + Intergenic
909820101 1:80051040-80051062 GGCGGGACTGAGTGGGACTGAGG + Intergenic
911052667 1:93684382-93684404 GGAGGGACTGAGGGGAAGAATGG - Intronic
912139330 1:106702663-106702685 AGAGGGACTGAGAAGAACTGAGG - Intergenic
912379935 1:109241905-109241927 GTCGGGACTGAGGGGAAGTGGGG - Intergenic
912430601 1:109626541-109626563 GGAGGGGCGGAGGGGCAGAGGGG + Intronic
912440227 1:109691980-109692002 GGAGGGGTGGAGGAGAGCTGAGG + Intronic
912518385 1:110229719-110229741 GGGGCAGCTGAGGGGAAGTGTGG + Intronic
912551211 1:110486619-110486641 GCAGGGGAGGAGGGGAACAGAGG - Intergenic
912696941 1:111848966-111848988 GGAGGGGCAGGAGAGAACTGGGG - Intronic
913177255 1:116286206-116286228 GGAATGCCTGAGGGGCACTGGGG + Intergenic
914713452 1:150235353-150235375 GCAGGGGCTGAGTGGGACTGGGG + Intronic
915347832 1:155207131-155207153 GGATGGGAGGAGGGGAACTAGGG - Intronic
915888148 1:159745370-159745392 GGAGGGGCTGAGGGGGTATGTGG + Intergenic
916481839 1:165221362-165221384 GGAGGGTCTGAGGAGATATGGGG - Intronic
916694638 1:167222023-167222045 GCAGGGGGTGGGGGGAACGGAGG - Intronic
917279389 1:173366482-173366504 GGAGGGGTTGAAGGAAACAGGGG + Intergenic
917922317 1:179760706-179760728 GCAGGAGCAGAGGGGAAGTGTGG + Intronic
917931110 1:179823488-179823510 GGAGGGGCTGAGTGCAGGTGTGG - Intergenic
918373160 1:183881865-183881887 GGAGGCCCTGAAGGGAGCTGAGG - Intronic
918542776 1:185649435-185649457 GGAGGTGCTGAGAGCAAGTGAGG + Intergenic
918567910 1:185953131-185953153 GAAGGGGTTGAGGGGTACTGAGG + Intronic
919263968 1:195237660-195237682 AGGGAGTCTGAGGGGAACTGAGG + Intergenic
919882884 1:201912391-201912413 GGAGGGAGTGAAGGGAGCTGTGG - Intronic
920186300 1:204161440-204161462 GGAGGGGCTCAGGGGACCTTGGG + Intronic
921320277 1:213931901-213931923 AGAGGGACTGGGGGAAACTGGGG - Intergenic
921814681 1:219550169-219550191 GGAGGGGGATAGGGGAGCTGGGG - Intergenic
921963015 1:221055881-221055903 GAAGGCTCTGAGGGGAACAGAGG + Intergenic
922116242 1:222617642-222617664 GGAGGTGCTGCGAGGGACTGGGG + Intergenic
923108144 1:230869429-230869451 AGAGGGGCTTGGGGGAAGTGGGG - Intronic
923125246 1:231028816-231028838 GGAGGGGTGGAGGGGAGCTCTGG - Intronic
923199071 1:231694335-231694357 GGAGGGGTTGGGGGGACCTCAGG - Exonic
923631888 1:235655285-235655307 AGAGGGGATGGGGGGAAATGAGG - Intergenic
924047961 1:240051912-240051934 GGAGAGGTTGTGGGGAAATGGGG - Intronic
924204700 1:241699580-241699602 GGGGTGGGTGGGGGGAACTGAGG + Intronic
1062817007 10:508257-508279 GGAGTGGGTGAGGGGCTCTGGGG - Intronic
1062960112 10:1567122-1567144 GGTGAGGCTGAGGGTGACTGGGG + Intronic
1063080382 10:2762149-2762171 GGCTGGGGTGAGGGGAAATGGGG - Intergenic
1063088709 10:2842347-2842369 GGAGAGGCTGTGGGGCACAGAGG - Intergenic
1063202958 10:3802330-3802352 GGAGGGGTTGAGCGGAACTTCGG - Intergenic
1063532924 10:6853110-6853132 GGAGATGCTGAAGGGAACTCAGG + Intergenic
1063583881 10:7333762-7333784 GGAGGCCCTGTGGGGAGCTGGGG - Intronic
1063592938 10:7409945-7409967 GAAGGGGCTGGAGGGAGCTGGGG - Intronic
1065684534 10:28270537-28270559 GGGGGGGAGGAGGGGAGCTGGGG + Intronic
1067022891 10:42817503-42817525 CAAGGGGCTGAGAGGAACTGAGG - Intronic
1067234679 10:44437615-44437637 GGAGGAGCTGATGGGCCCTGGGG + Intergenic
1067750788 10:48969779-48969801 GGAGGGGCTGGGGAGAGCTTGGG - Intronic
1067897036 10:50193626-50193648 TGAGGGGATGAGGGGTGCTGGGG + Intronic
1067951937 10:50748414-50748436 TGAGGGGATGAGGGGTGCTGGGG - Intronic
1068216596 10:53990662-53990684 GGAGGCGCTGAGAGCAAGTGAGG - Intronic
1069158008 10:65053767-65053789 TGAGGGGCTGAGGGGATGAGGGG - Intergenic
1069743557 10:70700550-70700572 GGAGGAGCTGAGGGGAGTGGTGG + Intronic
1069752093 10:70751462-70751484 GGAGAGCCTGAGGGGAGATGGGG - Exonic
1069891447 10:71655074-71655096 GGAGGAGGTGAGGGAAATTGTGG - Intronic
1070666740 10:78350418-78350440 GGAGGGGCTGTGGGGCAGAGGGG - Intergenic
1070806367 10:79273309-79273331 GGAGGGGCTGTTGGGAGCAGAGG - Intronic
1071044920 10:81361923-81361945 GGCGGGGGTGAGGGGGGCTGCGG - Intergenic
1071397570 10:85238564-85238586 GGAGGAGGTGAGGGGCCCTGTGG + Intergenic
1071499555 10:86193684-86193706 GGATGGGCTGATGTGAGCTGAGG - Intronic
1072358260 10:94633462-94633484 GGAAGGGTGGAGGGGAAATGTGG + Intergenic
1073073433 10:100808972-100808994 GGTGGGGCAGAGGGGAGATGCGG - Intronic
1073099906 10:101000862-101000884 GCAGGAGCTGCGGGGAGCTGGGG - Exonic
1073822972 10:107286401-107286423 TAAGGGGCTGAGGGGAGGTGGGG - Intergenic
1073862777 10:107766594-107766616 GGATGGGATGAGAGGAGCTGGGG - Intergenic
1074558858 10:114517133-114517155 GCATGGGCTGAGTTGAACTGTGG + Intronic
1075222639 10:120598443-120598465 GCAGGCTCTCAGGGGAACTGGGG + Exonic
1075328025 10:121550268-121550290 GGAGAGGCAGAGGAGAACTCTGG - Intronic
1075630623 10:123998716-123998738 GGAGGGGCTGGGGTGAGCAGGGG - Intergenic
1075726061 10:124611511-124611533 GGAGGGGCTTAGGGGACAAGGGG + Intronic
1076226085 10:128776822-128776844 GGAGGGGCTGAAGAGAACAAAGG + Intergenic
1076426068 10:130368450-130368472 GGAGGGACTGAGGGGGCCAGGGG + Intergenic
1076715515 10:132362015-132362037 GGAAGGGCTGAGCGGCCCTGAGG - Intronic
1076828255 10:132981331-132981353 GGAGGGGCTCAGGGGTGCTCAGG + Intergenic
1076835979 10:133021182-133021204 GGAGGGGCTGACGGGAAGGGCGG - Intergenic
1077248375 11:1549912-1549934 GGAGGGGCTGGGGGCAGGTGGGG - Intergenic
1077327042 11:1968406-1968428 GGAGGGGCTGTGTGGGGCTGTGG + Intronic
1077405100 11:2379225-2379247 GTGGGGGCTGAGGGAGACTGTGG + Intronic
1077405139 11:2379321-2379343 GTAGGGGCTGAGGGAGAGTGTGG + Intronic
1077405173 11:2379414-2379436 GTAGGGGCTGAGGGAGAGTGTGG + Intronic
1077405198 11:2379476-2379498 GCAGGGGCTGAGGGAGAGTGTGG + Intronic
1077433185 11:2526147-2526169 GGAGGAGCTGGGGTGATCTGGGG + Intronic
1077435500 11:2536916-2536938 GGAGGGACTGGGGGGGATTGGGG - Intronic
1077502781 11:2916825-2916847 GGGGGGCCTGAGGGGAAATCTGG + Intronic
1077506880 11:2933694-2933716 GGAGGGGGTGAGAGGAGCTAGGG - Intergenic
1077516383 11:3004427-3004449 GGAGGCTCTGGGAGGAACTGAGG - Intronic
1078337129 11:10473453-10473475 GGAGGGGTTGTGGGGAAGGGAGG + Intronic
1078475143 11:11622843-11622865 AGTGCCGCTGAGGGGAACTGAGG + Intergenic
1078538643 11:12195837-12195859 GGAGGGGGTGGTGGGAGCTGAGG + Intronic
1078552295 11:12289044-12289066 GGAGGGCCGGAGGGGATATGTGG + Intronic
1078558081 11:12347058-12347080 GGAGGGGCTGAGGGGCATGGAGG - Intronic
1078602862 11:12748914-12748936 GGAGGGGAGGAGGGGAACCTAGG + Intronic
1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG + Intronic
1078636478 11:13054937-13054959 GGAGGTGCTGAAGGGAAAGGAGG + Intergenic
1078853632 11:15188117-15188139 GGAGTAGCTTAGGGGAAGTGTGG + Intronic
1079064374 11:17276731-17276753 GGAGGGGCAGAGCGGAGCGGTGG + Intronic
1079080314 11:17409326-17409348 GGAGGGGGTGAGGGCAGCAGGGG - Intronic
1079086388 11:17448488-17448510 AGATGGGCTGAGGGGAAGGGAGG - Intronic
1079364461 11:19797207-19797229 GGAGGGGTGGAGGGGAAGTGGGG - Intronic
1080386919 11:31815896-31815918 AGAGGGGCTGACAGGAACTGCGG + Intronic
1080542354 11:33280015-33280037 GGGGGAGCTGAGGGGAGGTGGGG + Intronic
1080626509 11:34035296-34035318 GGAGGTACTGAGGGGACTTGGGG - Intergenic
1080874232 11:36261935-36261957 GGAGGAGCTGAGGGTATCTAGGG - Intergenic
1081626693 11:44660129-44660151 TGAGGGGCTGAGGGGATCAGAGG - Intergenic
1081666225 11:44918562-44918584 GGAGGGGAGGAGGGGCAATGGGG + Intronic
1083079820 11:60079640-60079662 GGAGGAGCAGAGGGGAACATGGG - Intergenic
1083385786 11:62308802-62308824 GGAGTGGGTGGGGGGAAGTGAGG - Intergenic
1083426822 11:62592310-62592332 GGAGGGACTACGGGGAGCTGGGG + Intergenic
1083463628 11:62831603-62831625 GGAGGGGCCGAAGGAAACCGCGG - Intronic
1083578984 11:63813273-63813295 GGAAGGGCCGAGGGGACCCGGGG - Intergenic
1083597055 11:63922980-63923002 GGAGTGGTGGAGGGGGACTGTGG - Intergenic
1083853108 11:65379193-65379215 GGGAGGGCTGTGGGGAACAGAGG - Intronic
1083860724 11:65418616-65418638 GGGGTGGCCAAGGGGAACTGGGG - Intergenic
1083926222 11:65808691-65808713 GGAGAAGGTGAGGGAAACTGAGG - Intergenic
1084020448 11:66414129-66414151 ACAGGGGCTGGGGGGCACTGAGG + Intergenic
1084143559 11:67250580-67250602 GGAGGGGCTGGGGGGAGAGGAGG + Exonic
1084171067 11:67401375-67401397 CGAGGCGCTGAGGGTAGCTGGGG - Intronic
1084177204 11:67429056-67429078 GGAGTGGGGAAGGGGAACTGGGG + Intronic
1084499214 11:69525029-69525051 TGAGGGGCTGGGGGGAACTGGGG + Intergenic
1084542001 11:69792664-69792686 GGAGGGGCTGTTGGGCTCTGGGG + Intergenic
1084677407 11:70643934-70643956 AGAGGGGCAGAGGAGATCTGGGG + Intronic
1084900092 11:72303187-72303209 CGGGGGACTGTGGGGAACTGTGG - Intronic
1084937830 11:72596419-72596441 GGATGGAGTGAGGGGAAATGGGG - Intronic
1085014918 11:73167645-73167667 GGAAGGGGTGAGGTGGACTGAGG + Intergenic
1085128586 11:74018723-74018745 GTAGGAGCAGAGGGGAAGTGAGG + Intronic
1085401424 11:76238148-76238170 GGAGGGGAAGTGGGGAACTGTGG - Intergenic
1085416342 11:76321466-76321488 GGGGGGGCGGGGGGGGACTGGGG - Intergenic
1085426725 11:76411345-76411367 GGAGAGGGTGATGGAAACTGTGG + Intronic
1085562499 11:77485182-77485204 GGTGGGGGTGAGGGGAATAGTGG + Intergenic
1085644418 11:78213857-78213879 GTAGGGCCTGAGGGAAGCTGTGG + Exonic
1085645193 11:78218251-78218273 GCAGGGACTGAGGGGAACCCTGG - Exonic
1087441215 11:98185577-98185599 AGAGGTGCAGACGGGAACTGGGG - Intergenic
1087559001 11:99760318-99760340 GGAGCGTCTGAGAGGATCTGGGG + Intronic
1088303566 11:108384703-108384725 GCAGAGGCTGCAGGGAACTGAGG + Intronic
1088645413 11:111913053-111913075 GGAGGGGATGAGGGGTAGTCTGG - Intronic
1089192342 11:116662064-116662086 GGAGAGGATGAGGGGGTCTGGGG + Intergenic
1089255846 11:117193512-117193534 GAAGGGGCTGAGGGGAGGTAGGG + Intronic
1089298057 11:117481517-117481539 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1089298071 11:117481546-117481568 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1089387465 11:118077667-118077689 GGAGTGGCAGAGGGCAACCGTGG - Intronic
1089533249 11:119145451-119145473 GGTGGGGGTGAGGAGATCTGGGG + Intergenic
1089643917 11:119865538-119865560 GGAGAGGCTGAGGCCATCTGGGG - Intergenic
1089784472 11:120898346-120898368 TGGGGGGCTGAGGGAAACGGGGG - Intronic
1089922220 11:122220148-122220170 AGAGAGTCTGATGGGAACTGGGG - Intergenic
1202810024 11_KI270721v1_random:23586-23608 GGAGGGGCTGTGTGGGGCTGTGG + Intergenic
1091587921 12:1826774-1826796 GGAGGGGCCGAGGGGACCAGAGG + Intronic
1091599325 12:1908489-1908511 GGAGAGGCCGAGGGCAGCTGCGG - Intronic
1091770623 12:3148880-3148902 GGAGGGGATGAGGAGAAGAGGGG + Intronic
1091875348 12:3929098-3929120 GGAGGGGCTGAGGAGAAAAGAGG + Intergenic
1091973170 12:4805224-4805246 AGAGGAGGTGAGGAGAACTGAGG - Intronic
1093333991 12:17878582-17878604 GGAAATGCAGAGGGGAACTGTGG - Intergenic
1094086005 12:26592262-26592284 AGTGGGGCAGAGGGGAAGTGGGG + Intronic
1094311408 12:29087410-29087432 GGAGGGGCTGGGGCCAACTGTGG - Intergenic
1095749730 12:45697107-45697129 AGGGAGGCTGGGGGGAACTGAGG - Intergenic
1096112656 12:49038543-49038565 GGTGGGGCTGAGGGTTTCTGTGG + Exonic
1096121870 12:49093853-49093875 GGAAGGGCTGGGGTGAGCTGGGG - Intronic
1096202730 12:49697026-49697048 GGAGGGGGAGAGGGGAAATAGGG + Intronic
1096415488 12:51408683-51408705 AGTATGGCTGAGGGGAACTGGGG + Intronic
1096652528 12:53068896-53068918 GGAGGTGCTGAGGGGAGCCCAGG + Intronic
1096789065 12:54034035-54034057 GGAGGGGCTGAGGGGGGGTTGGG - Intronic
1097009150 12:55940236-55940258 GGAGGGGCTGAGGGCAGCAATGG - Intronic
1097234150 12:57528316-57528338 GGAGGGGAGGAGGGGGACTTAGG + Exonic
1097980961 12:65737764-65737786 GGAGGGGCCCAGGGTGACTGTGG + Intergenic
1099902439 12:88728318-88728340 GAAGGGGCTGAGGGTAAAAGAGG + Intergenic
1100351592 12:93788858-93788880 GGAGAGCCTTTGGGGAACTGTGG + Intronic
1100391381 12:94148655-94148677 GGAGGCGCGGAGGGGAAGGGAGG - Intergenic
1100853291 12:98736064-98736086 GGAGAGGCAGAGAGGAATTGGGG + Intronic
1101249434 12:102917371-102917393 GGAGGGGCTGAGGGAGGGTGTGG + Exonic
1101568491 12:105932055-105932077 GGAGGCGCTGGGGTGAGCTGGGG + Intergenic
1101793755 12:107954130-107954152 AGAGGGGCTGAGGGGCAAGGAGG + Intergenic
1101797972 12:107993835-107993857 GGAAGGGTGGAGGGGACCTGGGG - Intergenic
1101802948 12:108038248-108038270 GGAGGGGCTGGGGATATCTGAGG + Intergenic
1102069460 12:110005482-110005504 GGAGGGGTTGGGGAGAAATGAGG - Intronic
1102908776 12:116696876-116696898 GGAGGAGCCGAGAGGAGCTGGGG + Intergenic
1102985689 12:117276608-117276630 GGAGGGGGTGAGGGGAAGATGGG - Intronic
1103180003 12:118902553-118902575 TGAGGGGATGAAGGGAACTCTGG + Intergenic
1103726502 12:122999872-122999894 GGAGGGGCAGAAGGGGCCTGGGG - Intronic
1104552209 12:129767499-129767521 TCAGGGGCTGAGGGGACATGGGG - Intronic
1104666844 12:130653618-130653640 GGACAGGCTGAGGGGAACTGTGG - Intronic
1105628938 13:22141938-22141960 GTGGGGGCAGAGGAGAACTGAGG - Intergenic
1106308864 13:28535381-28535403 GGAGAAGCTGAGGGGGACTGAGG + Intergenic
1106836811 13:33643703-33643725 AGAGGCGCTGGGGGGAAGTGAGG - Intergenic
1107010143 13:35662315-35662337 GGTGGGCCTGAGGGCAACGGCGG + Intronic
1108286570 13:48915040-48915062 GGATAGGCTGAGGAGACCTGAGG - Intergenic
1109079195 13:57876327-57876349 GGATGTGCTGAGAGCAACTGGGG + Intergenic
1110902167 13:80837178-80837200 GGCGGTGCAGAGGGGAAATGTGG - Intergenic
1111485553 13:88895096-88895118 GGAAGGGCTGTCTGGAACTGGGG - Intergenic
1112401918 13:99085794-99085816 GGAGGGGCGCAGGGGAATTGAGG - Intronic
1112690671 13:101890455-101890477 GGAGGGACTTAGAGGAACAGAGG - Intronic
1113596383 13:111537100-111537122 GGAGGTGCTGAGGGGCTCAGAGG - Intergenic
1113629069 13:111868664-111868686 GGAGGGGCGGTGGGGAAAGGAGG - Intergenic
1113792975 13:113040565-113040587 GGAGGCGCTGAGGGGACGTGAGG - Intronic
1113921529 13:113915835-113915857 GGAGGGGCTGAAAGGACCTGGGG + Intergenic
1114530038 14:23389752-23389774 GGAGGGGCTGAGTCGACCAGAGG + Intronic
1114712922 14:24796376-24796398 GGAGGTGGTGAGGGGAGGTGAGG - Intergenic
1115149740 14:30270709-30270731 TGACAGGCTGAGGGGAGCTGGGG - Intergenic
1117124990 14:52613482-52613504 GGAGGGGTTGGGGAGAAGTGGGG - Intronic
1117404332 14:55387240-55387262 GGGTGTGCAGAGGGGAACTGTGG - Intronic
1118395686 14:65334537-65334559 GGAGGAGCTGAGGTGGTCTGAGG - Intergenic
1118865764 14:69702415-69702437 GGAAGGTCTGAGTGGACCTGAGG - Intronic
1119325797 14:73759160-73759182 GCAGGGGCGTTGGGGAACTGGGG - Intronic
1119410435 14:74426692-74426714 GGAGGGGAAGAGGGGAAGAGGGG - Intergenic
1119650548 14:76379967-76379989 GGAGGGGCAGAGGGGACTTTCGG + Intronic
1119890643 14:78179564-78179586 GGAGGGTCGGAAGGGAACTAGGG + Intergenic
1120637084 14:86965787-86965809 GGAGGGACTGTCTGGAACTGTGG + Intergenic
1121508174 14:94492247-94492269 GGAGAGGATGAGAGGAACTAGGG + Intronic
1122191669 14:100049792-100049814 GGAGAGGCTGGGGGAGACTGAGG - Intronic
1122202833 14:100132907-100132929 GGAGGGGCGGAGGGTCTCTGCGG + Intronic
1122581902 14:102776794-102776816 GGTGGGGCTGAGGGTGACTCAGG - Intergenic
1122636506 14:103132136-103132158 GGAGGGGCTGAGGGGATTGAAGG - Intronic
1122716770 14:103700791-103700813 GCAGGGACTGGGGGGAGCTGGGG + Intronic
1122825758 14:104369677-104369699 GAAGGAGCTGAGGGAGACTGGGG - Intergenic
1122879375 14:104683200-104683222 GGAGGGGAGGAGGGGCCCTGGGG + Intergenic
1122883239 14:104699440-104699462 GGAGGGGCGTTGGGGACCTGAGG + Intronic
1123120324 14:105913435-105913457 GGAGGGGCTGAGGTGATGTCTGG + Intergenic
1123424046 15:20154676-20154698 CAAGGGGCTAAGAGGAACTGAGG - Intergenic
1123450824 15:20358026-20358048 GGAGGAGCTGGGGGGAGCAGAGG + Intergenic
1123512390 15:21011666-21011688 GGAGGGGCTGAGGTGACATCCGG + Intergenic
1123533266 15:21161205-21161227 CAAGGGGCTAAGAGGAACTGAGG - Intergenic
1123806261 15:23877159-23877181 GAAGAGGCTGAGGGGAAGTCAGG + Intergenic
1124152714 15:27196299-27196321 GGGAGGGCTGAGGGGAGCAGGGG - Intronic
1124747749 15:32352359-32352381 GGAGGGGCTGGGGGGGAAGGAGG + Intergenic
1125212009 15:37227667-37227689 GGAGAGGCTGAGTGCAAATGTGG + Intergenic
1125361693 15:38871391-38871413 GGAGGGGCAGAGGAGGAGTGTGG - Intergenic
1125610005 15:40963534-40963556 GGAGGAGCTCAGAGGACCTGTGG + Intergenic
1125679679 15:41522974-41522996 GGAGAGTCTGAGGGGGACTCTGG + Intronic
1125716878 15:41824356-41824378 GAAGGGACTGAGGGCAAGTGGGG + Intronic
1125721567 15:41847555-41847577 GGAGGAGGTGTGGGGGACTGGGG - Intronic
1125724731 15:41862463-41862485 ACAGGGGCTGAGGGGAGGTGTGG + Intronic
1125733722 15:41909238-41909260 GCAGGGGCTGTGGGGCTCTGCGG - Intronic
1125754118 15:42050727-42050749 GGACGGGCTGTGTGGAGCTGAGG + Exonic
1126292663 15:47099657-47099679 GGGGAAGCTGAGGGGATCTGAGG - Intergenic
1127626220 15:60782623-60782645 GGAGGGGCAGATGGCAGCTGTGG - Intronic
1128016862 15:64355797-64355819 GGAGGGGCTGAGGGACACAGCGG - Intronic
1128234554 15:66058928-66058950 GAAGGGGCTGAGGTGGTCTGGGG - Intronic
1128256451 15:66200922-66200944 GGGAGGGCTGAGGGGTACTTTGG - Intronic
1128780000 15:70353069-70353091 GCAGGGGCTCAGGGGGAATGGGG - Intergenic
1128834110 15:70795227-70795249 GGAGGGGCTGAGGGAGGGTGGGG + Intergenic
1128990997 15:72260420-72260442 GGAGGGTGGGAGTGGAACTGTGG - Intronic
1129077344 15:73008280-73008302 GGAGAGGGTGAGGGGTACGGTGG + Intergenic
1129101137 15:73265218-73265240 GGAGGGGATGAGGGAAAAGGAGG + Intronic
1129167319 15:73786082-73786104 GGAGGTGCTGGGGGACACTGTGG + Intergenic
1129250050 15:74303729-74303751 GGAGGAGCTGAGGAGGGCTGGGG - Intronic
1129262104 15:74374311-74374333 GGAGGTGCTGGAGGGGACTGCGG - Intergenic
1129323511 15:74787657-74787679 GGAGGGGTGGAGGGAAGCTGCGG - Intronic
1129359058 15:75012997-75013019 GGGGAGGTTGAGGGAAACTGAGG - Intronic
1129685284 15:77682665-77682687 GAAGGGGGTGGGGAGAACTGGGG - Intronic
1129942386 15:79509789-79509811 GGAGGGTCTGAGAGAAACTCAGG - Intergenic
1130202976 15:81850614-81850636 AGAAGGGGTGAGGGGAAATGTGG + Intergenic
1130255338 15:82323368-82323390 GGAGGGCCGGAGGGAAACTGAGG - Intergenic
1130486033 15:84398992-84399014 GTAGGGGCTGAAGGGATCAGGGG + Intergenic
1130599627 15:85266618-85266640 GGAGGGCCGGAGGGAAACTGAGG + Intergenic
1130691552 15:86085710-86085732 GGAAGGGCTGGGATGAACTGAGG + Intergenic
1130910470 15:88267058-88267080 GGAGGGGATGAGGGGGAAGGGGG + Intergenic
1130932126 15:88437029-88437051 AGAGGGAGTGAGGGGAACTGTGG - Intergenic
1131034321 15:89211185-89211207 GGAGGGGCTGATGGACAATGAGG - Intronic
1131236704 15:90703114-90703136 GGAGTGGGTGAGGGGATCTCAGG - Intergenic
1131612860 15:93983367-93983389 GGAGAGGCTGAAGGGATATGGGG - Intergenic
1131679575 15:94707380-94707402 GGAGGGAGTGAGGAGAAATGAGG - Intergenic
1132244240 15:100281662-100281684 AATGGGGCTGAGGGGAACAGAGG + Intronic
1132400293 15:101501086-101501108 GAAGAGGCAGAGGGGCACTGTGG + Intronic
1132599202 16:766529-766551 GGAAGGGCTGAGGGGCAGAGTGG + Intronic
1132756655 16:1488490-1488512 GAAGGGAGTCAGGGGAACTGGGG - Intronic
1132977686 16:2718871-2718893 GTGGGGGCTGATGGGAAATGGGG + Intronic
1133027659 16:2995671-2995693 GGAGGGGCTGGGGGAGAATGTGG + Intergenic
1133126081 16:3646845-3646867 GGCGGGGCTGAGGGGGAGCGGGG + Intronic
1133322783 16:4924735-4924757 GCAGGGGCTCTGGGGACCTGGGG - Intronic
1133813243 16:9177394-9177416 GGAGGGGAAGAGGGGAAGGGAGG - Intergenic
1134135791 16:11675608-11675630 TCAGGGACTGAGGGCAACTGGGG - Intronic
1134200656 16:12195895-12195917 GGAGAGGCTGAAGTGAACTGTGG + Intronic
1134388936 16:13800754-13800776 GGAGGGGCTGAGCAGATTTGGGG - Intergenic
1134795866 16:17036223-17036245 GGAGGGGCTGAACAGAACTTAGG + Intergenic
1134915531 16:18067581-18067603 CGAGGGTCTGGGGGGAAGTGGGG + Intergenic
1135195372 16:20389773-20389795 GGAGGGGCTGATGGGTGATGGGG + Intronic
1135712421 16:24729458-24729480 GGAGTGGCTGGGGGGGCCTGCGG - Intergenic
1136136976 16:28262159-28262181 GGAGGGGCAGTGGGGCAATGAGG + Intergenic
1136236075 16:28914478-28914500 GGAGGAGCTGAGCGGAGATGGGG - Exonic
1136295850 16:29301649-29301671 GGCGGGGCACAGGGGAACAGGGG + Intergenic
1136356609 16:29748359-29748381 AGAGGCGCGGACGGGAACTGGGG + Intergenic
1136381182 16:29896735-29896757 AGAGAGGCTGCTGGGAACTGTGG - Intronic
1136397853 16:30002821-30002843 GGATGGGCTGAGGGGCAGAGCGG + Intronic
1136478182 16:30526198-30526220 GGAGGGGCCGGCGGGGACTGGGG - Intronic
1136508436 16:30721270-30721292 GGCTGGGCTCAGGCGAACTGGGG - Exonic
1136656240 16:31711000-31711022 GGAGAGGCTGAGGGGAATATGGG - Intergenic
1136860823 16:33701210-33701232 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1137567393 16:49542101-49542123 GCAGGGGCTGAGAGGGGCTGTGG - Intronic
1137926424 16:52546415-52546437 GGAGGGGCTGAGGAGAGCGCCGG + Intronic
1138116061 16:54361634-54361656 GAAGGGGAGGAGGGGAAGTGGGG + Intergenic
1139428855 16:66900395-66900417 GGAGTGGCAGAGGGGGTCTGGGG + Intergenic
1139546634 16:67652871-67652893 GGAGGGGCGGAGGGGCAGAGGGG + Intronic
1139653365 16:68373626-68373648 GCAGGGACTGATGGGGACTGAGG - Intronic
1140407513 16:74720732-74720754 GGAGGGTCTGAGAAGAAATGGGG - Intronic
1140910400 16:79446099-79446121 GGACGGGCAGAGGGGAAAGGAGG + Intergenic
1141026462 16:80553520-80553542 GGAGGGGCTTATGGGGAATGGGG - Intergenic
1141471280 16:84240209-84240231 GGAGGAGCAGAGGGCAACTTGGG + Intergenic
1141636961 16:85319103-85319125 GGAGGGGGTGAGCGATACTGAGG - Intergenic
1141686090 16:85570768-85570790 GGAGGGGCTGAGGGGGAGGGTGG + Intergenic
1141711822 16:85704132-85704154 GGACGGGCTGAGGGGGACAGCGG + Intronic
1141928048 16:87182131-87182153 GGAAGGGCTCAGGAGAACTGGGG - Intronic
1141980580 16:87547606-87547628 GGAGGGACTGAAGGGCTCTGGGG + Intergenic
1142101769 16:88275836-88275858 GGCGGGGCACAGGGGAACAGGGG + Intergenic
1142135594 16:88450603-88450625 GCAGGGGCAGATGGAAACTGGGG + Intergenic
1142192271 16:88723446-88723468 GGAGGGGCTCAGGGACACGGAGG - Intronic
1142228727 16:88889463-88889485 GGAGGGACTGAGGGGAATGAGGG + Intronic
1142232307 16:88905652-88905674 GGCGGGCCTGAGGGGAGGTGGGG + Intronic
1142427930 16:90010737-90010759 GGAGGGGCTGAGGGGATCTGTGG - Intronic
1203122318 16_KI270728v1_random:1549393-1549415 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1142672651 17:1494215-1494237 GAAGGGGCTGAGGAGAAGTGGGG + Intergenic
1142741093 17:1932423-1932445 GGAGGGGCTGAGGGCGGCCGCGG + Intergenic
1142811438 17:2397322-2397344 GAAGGGGCTGGGGACAACTGAGG - Intronic
1142950184 17:3472085-3472107 CCAGGGGGTGAGGGGAAGTGGGG - Exonic
1143307611 17:5959921-5959943 GGAGGGGCTCAGGGTAGCAGTGG + Intronic
1143445397 17:7006214-7006236 AGAGGAGGTGAGGGGAGCTGTGG + Intronic
1143818963 17:9544014-9544036 GGAGGGGCAGAGGGGCAGGGAGG - Intronic
1143965660 17:10755047-10755069 GGAGGGGCTTAGTGATACTGCGG - Intergenic
1144037157 17:11377378-11377400 GGAGGGTGTGAGGGAAACAGTGG + Intronic
1144330641 17:14220964-14220986 GGAGGGTTTGAGGGGAAGGGGGG + Intergenic
1144572377 17:16407833-16407855 GGTGGGGGTGAGGGGTAGTGGGG + Intergenic
1144604639 17:16653717-16653739 GGAGGGGCGGCGGGCAACCGAGG + Intronic
1144835342 17:18153943-18153965 GGAGGGGCTGAAGCGAGCAGAGG + Intronic
1145261984 17:21360010-21360032 AGGAGGGCTGTGGGGAACTGTGG - Intergenic
1145766319 17:27460545-27460567 GGAGGCGATGTTGGGAACTGTGG + Intronic
1146270856 17:31484736-31484758 CAAGAGGCTGAGGGGAACAGAGG - Intronic
1146460312 17:33041039-33041061 GGAGGGGCTCAGGCAAACAGGGG - Intronic
1146911241 17:36649770-36649792 TGAGGGGCAGAGGGGAGCTCAGG + Intergenic
1147037903 17:37695438-37695460 GGCAGTGCTGAGGGGAAATGTGG + Intronic
1147158823 17:38559173-38559195 GGAGGAGCTGAGAGGACTTGGGG + Intronic
1147165445 17:38590857-38590879 GGAAGGACAGAGGGGACCTGTGG - Intronic
1147186541 17:38716312-38716334 GGAGGGAGTGCGGGGATCTGGGG + Intronic
1147251227 17:39153622-39153644 TGAGGGACTGAAAGGAACTGGGG - Intronic
1147316694 17:39624379-39624401 GGAGGGGCTGCTGGGGACAGTGG - Intergenic
1147330655 17:39697126-39697148 GGTGAGGATCAGGGGAACTGAGG - Intronic
1147387047 17:40088987-40089009 AGAGGGGCAGGGGGGTACTGGGG - Intronic
1147766160 17:42837714-42837736 GGATGGGGTGAGGGGAGGTGAGG - Intronic
1148104514 17:45112255-45112277 GGGAGGACAGAGGGGAACTGAGG + Exonic
1148329763 17:46806820-46806842 GGAGGAGCAGAGGGGAGCGGCGG - Intronic
1148577101 17:48719889-48719911 GGAGGGGTGGAGGGGAAGGGCGG - Intergenic
1148846770 17:50534240-50534262 GCAGGGGCTGGGGGGAAGGGCGG - Intronic
1149529719 17:57385308-57385330 GGAGGGTCTGAGGGGAGATGAGG - Intronic
1149559216 17:57596146-57596168 GGAGGGTAGGAGAGGAACTGAGG + Intronic
1149891180 17:60391876-60391898 GGAGGCGCTGAGGAGAGGTGAGG - Exonic
1151490693 17:74431076-74431098 GTAGGGGCTGAGGCGCACAGAGG - Exonic
1151509240 17:74548106-74548128 GCAGGAGCTGAGGGGGACTGTGG - Intergenic
1151522676 17:74641552-74641574 GGTGGGGCTGGGGTGCACTGGGG - Intergenic
1151570661 17:74923837-74923859 CGTGGGGGAGAGGGGAACTGGGG + Intergenic
1152013438 17:77734837-77734859 GGCGGGGCTGAGCGGGAGTGGGG + Intergenic
1152160518 17:78665687-78665709 GAAGGGGCTGGGGAGAGCTGCGG + Intergenic
1152334871 17:79695097-79695119 GGAGGGGCTGAGGGAATCTGGGG - Intergenic
1152337616 17:79707309-79707331 GGAGGAGCTGGGGGGAGCAGAGG - Intergenic
1152376671 17:79922209-79922231 GGAGGGGCTGGCGGGAAGGGCGG - Intergenic
1152711128 17:81871025-81871047 GGAGGGGCGGCGGGGACCAGGGG - Intronic
1152795500 17:82304304-82304326 GGAGGGGCTGAGGGGGCCCCTGG + Intergenic
1152811126 17:82383320-82383342 GGAGGGTCTGGGGGGCATTGTGG - Intergenic
1152817197 17:82415006-82415028 GGAGCGGGGGAGGGGAGCTGGGG + Intronic
1152879811 17:82808480-82808502 GGAGGGGCTGACAGGTGCTGGGG + Intronic
1153004680 18:487312-487334 GGTGGTTTTGAGGGGAACTGAGG + Intronic
1153643509 18:7175052-7175074 GGATGAGCTGAGGGGGACAGTGG - Intergenic
1153872614 18:9334702-9334724 GGAGGGGAAGAGGGGAGCAGGGG + Intergenic
1155045306 18:22097967-22097989 GGAAGGGCTGAGGGGAGGTCAGG + Intronic
1155505494 18:26528813-26528835 GGGGAGGAGGAGGGGAACTGTGG - Intronic
1157134338 18:45039304-45039326 GGAGGCACTGTGGGGAACAGAGG - Intronic
1157470139 18:47982557-47982579 GGAGGGGGAGAGGGGAAGAGGGG + Intergenic
1157475377 18:48020674-48020696 GGAGGGGAGGAGGGGAGTTGGGG - Intergenic
1157763172 18:50280030-50280052 GGAAGGGATGAGGGAAACTGAGG + Intronic
1158269901 18:55701432-55701454 GGTGGGGCGGGGGGGCACTGGGG - Intergenic
1159629513 18:70733318-70733340 GTAGGACCTGAGGGGAAATGTGG + Intergenic
1159949283 18:74468653-74468675 GGAGGAGATGGAGGGAACTGGGG + Intergenic
1160496032 18:79376128-79376150 TGAGGGGCTGGGGGCAACAGAGG - Intronic
1160831344 19:1106108-1106130 GGGGGGGCTTGGGGGCACTGTGG + Intronic
1160902475 19:1435512-1435534 GTAGTGTCTGAGGTGAACTGTGG + Exonic
1160917978 19:1506774-1506796 GCAGGGGCTGCGGGGGGCTGAGG + Exonic
1160975108 19:1789275-1789297 GGTGGGACTGGGGGGACCTGGGG - Intronic
1161052826 19:2173878-2173900 GGAGGGGCTCAGGAGGGCTGAGG - Intronic
1161085930 19:2334863-2334885 GGGGAGGCCCAGGGGAACTGGGG - Intronic
1161169866 19:2807308-2807330 CGAGGGGTTGCCGGGAACTGCGG + Intronic
1161349488 19:3784176-3784198 GGAGGGGCTGCTGGCAGCTGGGG - Exonic
1161585364 19:5102657-5102679 GGAGAGCCTGAGGGGAGCCGGGG - Intronic
1161631549 19:5359166-5359188 GGAGGGACTTTGGGGAGCTGAGG + Intergenic
1161813012 19:6481601-6481623 GCCGGGGCAGAGGGGAGCTGGGG - Intronic
1162062324 19:8103699-8103721 GAAGGGGTGGAGGGGAACAGTGG + Intronic
1162145759 19:8611307-8611329 GGAGGGGCTGAGTGGGGTTGGGG + Intergenic
1162294239 19:9802189-9802211 GGAGGGGTTGAGGGGACTTCAGG - Intergenic
1162552467 19:11365284-11365306 GGAGGGGCTGAGAGGAAAAGGGG - Exonic
1162567939 19:11454336-11454358 GGAGGGTCTGCAGGGAATTGGGG - Exonic
1162583372 19:11544289-11544311 GGGAGGGCTCAGGGGACCTGAGG + Intronic
1162811416 19:13166355-13166377 GAGGGAACTGAGGGGAACTGAGG + Intergenic
1162835984 19:13318351-13318373 GGAGTGGTTGAGGGGAAAAGAGG + Intronic
1162909609 19:13842136-13842158 GCAGGGGCTGGTGGGAGCTGGGG - Intergenic
1162947952 19:14054939-14054961 GGAAGGGCTGAGGGCCACAGAGG - Exonic
1163035617 19:14567296-14567318 GGAGGGGCTGAGGGTTACTCTGG - Intronic
1163441536 19:17324621-17324643 AGAGGGGCTGAAGGGGACAGGGG - Intronic
1163497544 19:17655532-17655554 GGAAGGGGTGAGGGGCACTGAGG - Intronic
1163672552 19:18637290-18637312 GGAGGAGCCGAGGGCTACTGAGG + Intronic
1163672673 19:18637688-18637710 GGGGAGGCTGAGGGGGCCTGGGG + Intronic
1163751617 19:19081586-19081608 GGTGGGGGTCATGGGAACTGGGG + Intronic
1163871036 19:19821545-19821567 AGAGGGGCTGGTTGGAACTGGGG - Intronic
1164781432 19:30896709-30896731 GGAAGGGGGGAGGGGAAATGAGG - Intergenic
1165007692 19:32819907-32819929 GGAGAGGCTGAGGTGGGCTGTGG + Intronic
1165072328 19:33262614-33262636 AGAGGGGCTGGGGGGTCCTGGGG - Intergenic
1165079666 19:33300129-33300151 GGAGGGGCTGGGGAAAGCTGAGG + Exonic
1165429983 19:35766999-35767021 GCTGGGTCTGAGGGGGACTGAGG + Intronic
1165458053 19:35926296-35926318 GGAGGAGCTGAGGGGCCCAGTGG - Intergenic
1166008919 19:39926913-39926935 GGAGGGGCTGAGAAGACTTGAGG + Intronic
1166260980 19:41640583-41640605 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1166910234 19:46149290-46149312 GGAGGGGGAGAGGGGAAGAGGGG - Intronic
1167036618 19:46998783-46998805 GGAGGGGCTGATGGAAACAGTGG - Intronic
1167100509 19:47401743-47401765 GGAGGGGCTGAGGGGCACTTGGG + Intergenic
1167216594 19:48169821-48169843 GGAGGGGCTGAAGGGAGCTAAGG - Intronic
1167368171 19:49065369-49065391 GGAGGTGGTGGGGGGAACTGTGG - Intergenic
1167492909 19:49802209-49802231 GGAGGGGCTCAGGGAAAACGGGG - Intronic
1167509457 19:49888467-49888489 CGAGGGGCTGTGGGGCTCTGCGG - Exonic
1167530758 19:50014756-50014778 GTGGGGTCTGAGGGGAAATGGGG + Intronic
1167638843 19:50669116-50669138 GGAGGGGGTGAGGCGCCCTGAGG + Exonic
1167689245 19:50975226-50975248 GGAGGGGCTGGGGGGGAGTCTGG + Intergenic
1167689261 19:50975267-50975289 GGAGGGGCTGGGGGGGAGTCTGG + Intergenic
1167742198 19:51330269-51330291 GGAGGGGGTGGGGGGCCCTGGGG + Exonic
1167792005 19:51689037-51689059 GGAGAGGCGGAGGGGAGCTAGGG + Intergenic
1167912521 19:52715679-52715701 AGAGCAGCTGAGAGGAACTGAGG + Intronic
1167915954 19:52740191-52740213 AGAGCAGCTGAGAGGAACTGAGG + Intergenic
1167920398 19:52778673-52778695 GGAGCAGCTGAGAGGAACTAAGG + Intronic
1167922226 19:52791344-52791366 AGAGCAGCTGAGAGGAACTGAGG + Intronic
1168243517 19:55098727-55098749 TGAGGAGCTGAGGGGACATGGGG + Intronic
1168323577 19:55525615-55525637 GGAGGGGCTTGGGGGCACGGGGG - Intergenic
1168428594 19:56258877-56258899 GGGACAGCTGAGGGGAACTGAGG - Intronic
925009950 2:476302-476324 GGAGGAGCAGAGAGGGACTGTGG + Intergenic
925987623 2:9229328-9229350 GGTGGGGCTGAGGCTCACTGTGG - Intronic
926138073 2:10351402-10351424 TGGGAGGCTGAGGGGAAATGGGG + Intronic
926629652 2:15124922-15124944 GGCAGTGCTGAGGGGAAATGTGG + Intergenic
926688000 2:15712966-15712988 GGTAGAGCTTAGGGGAACTGTGG + Intronic
926730909 2:16034663-16034685 GGAGGGTTTGGGGGGAAGTGGGG + Intergenic
926812995 2:16772948-16772970 AGGGGGGTTGAGGGTAACTGGGG - Intergenic
927074771 2:19566822-19566844 GGAGAGGCTGAGGAGAGCTTGGG - Intergenic
927111209 2:19864899-19864921 GGTGGGGATGAGGGCAACAGGGG - Intergenic
927126221 2:20013954-20013976 ACAGGAGCTGAGGGGAAGTGGGG + Intergenic
927197625 2:20559190-20559212 GCTGGCCCTGAGGGGAACTGGGG - Intergenic
927393123 2:22618706-22618728 GGAGCAGCTGTGGAGAACTGAGG - Intergenic
927450597 2:23206277-23206299 GGAGGGGCTCAAGAGAATTGAGG - Intergenic
927866941 2:26595153-26595175 GTAGGTGCTGTGGGGGACTGAGG - Intronic
927926088 2:27014726-27014748 GGTGGGGCTGAGGGGTTCTGAGG - Intronic
927965230 2:27263876-27263898 AGAGGGGCTGAGGGGCAGCGGGG + Intronic
928207969 2:29300617-29300639 GGAGGGGATGAGGAGAAAGGTGG + Intronic
928464782 2:31513666-31513688 GAAGGGGCTGAGTGGCACTTGGG - Intergenic
929145662 2:38705253-38705275 GAAGGGGCTTAGTGGGACTGTGG + Intronic
929260993 2:39866459-39866481 GGAGGGGCTGAAGGGAGCTTGGG - Intergenic
929462333 2:42112037-42112059 GCAGGTGCAGAGGGGAGCTGGGG - Intergenic
929826013 2:45310274-45310296 GGATGGACTGAGGGGACTTGGGG - Intergenic
929826049 2:45310417-45310439 GGATGGACTGAGGGGACTTGGGG - Intergenic
929905730 2:46044835-46044857 GGAGAGGCAGAGCGGAGCTGAGG - Intronic
930348688 2:50220843-50220865 AGAGTGGCTTAGGGGAATTGTGG - Intronic
930947040 2:57087174-57087196 GTAGGGGATGAGGGGTACAGGGG - Intergenic
930952146 2:57156012-57156034 GGTAGTGCTGAGGGGAAATGTGG - Intergenic
931338453 2:61374301-61374323 GGAGGTGCTGAGGGGCAGTGTGG - Intronic
931467743 2:62506137-62506159 TGAGGGGGTGAGGGATACTGAGG - Exonic
931567430 2:63629309-63629331 GCACGGCCTGAGGGGAACTTTGG - Intronic
931643909 2:64404552-64404574 GGAGGGGCTGAGGGACAACGTGG - Intergenic
932605579 2:73163306-73163328 GGTGGGGGTGAGGGGAGGTGGGG - Intergenic
932719855 2:74130983-74131005 GGTTGGACGGAGGGGAACTGCGG + Intronic
932790913 2:74654146-74654168 GGCGGGGCTGAGGGGAGGAGAGG - Intergenic
933158687 2:79001308-79001330 ACAGAGGCTGAGGGAAACTGAGG - Intergenic
933178703 2:79205667-79205689 GGTTGGGCTCAGGGGAAATGAGG - Intronic
933519761 2:83355694-83355716 GCATGGGGTGAGGGGAAATGGGG - Intergenic
934081432 2:88471872-88471894 GAAGGGGCTGAGGTGGACAGGGG - Intergenic
934121814 2:88847548-88847570 GGAAAGGATGAGAGGAACTGGGG + Intergenic
934459202 2:94202366-94202388 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
934474758 2:94586785-94586807 GAAGGGGGAGAGGGGAACTCAGG - Intergenic
935082068 2:99807904-99807926 GAAGGGGCTCAGGGGCACAGAGG - Intronic
935123015 2:100198613-100198635 GGAGGGGGTGAGGGCAAATGCGG - Intergenic
935724795 2:106014197-106014219 CCAGGGGGTGAGGGGAAATGGGG - Intergenic
936016014 2:108959575-108959597 CATGGGGCTGAGGGGAGCTGGGG + Intronic
936161258 2:110085813-110085835 AGTGGGGCTGAGGGTACCTGAGG - Intronic
936183405 2:110285541-110285563 AGTGGGGCTGAGGGTACCTGAGG + Intergenic
936748429 2:115610212-115610234 TGGGGGGGTGAGGGGAACTGAGG - Intronic
937237011 2:120437137-120437159 GGAGGGGCAGAGTGGAGCTTCGG + Intergenic
937278728 2:120703009-120703031 GGAGGGCCTGAAGTGACCTGGGG + Intergenic
937341659 2:121095302-121095324 GGAGGAGCAGAGGGGAAATGTGG + Intergenic
937477710 2:122229806-122229828 GTAGGGGATGGGGGAAACTGAGG - Intergenic
938341837 2:130541124-130541146 GGATGTGCTGAGGGGAAAAGAGG + Intronic
938347993 2:130579587-130579609 GGATGTGCTGAGGGGAAAAGAGG - Intronic
938490160 2:131756966-131756988 GAAGGCCCTGAGGGGAAGTGAGG + Intronic
939167419 2:138654290-138654312 GGAGGAGGTGAGTGGAGCTGTGG + Intergenic
939280170 2:140053892-140053914 GGAAGGGGAGAGGGGAAATGTGG + Intergenic
941490461 2:166137159-166137181 TGAAGGGCTGGTGGGAACTGGGG + Intergenic
941820659 2:169840948-169840970 GGAGGGGCCCAGGGTACCTGTGG - Intronic
942246748 2:174014902-174014924 GCAGGGGCTGTGGAGAACTGGGG + Intergenic
943148314 2:184074982-184075004 GGAGGGAGGGAGGGGAACAGTGG - Intergenic
944151040 2:196559199-196559221 GGAGGGTCTAATGGGAACTGTGG - Intronic
944427939 2:199603391-199603413 GCAGGGGCAGAAGGGAGCTGGGG + Intergenic
945038144 2:205721907-205721929 GGAGGGGCAAAGGGGAGCTTGGG - Intronic
945212404 2:207397472-207397494 GGAGGGTTTGTGGGGAATTGGGG - Intergenic
945463608 2:210141108-210141130 GGAGGGAGTGAGGGGAAGAGAGG - Intronic
946021388 2:216642724-216642746 GGAGGGACTATGGGGAACAGAGG + Intronic
946389785 2:219408541-219408563 GGAGGGGTTGATGAGAATTGGGG + Intergenic
947433285 2:230049624-230049646 GGAGGGGTTGGGGTGAAGTGGGG + Intronic
947752403 2:232539866-232539888 GGAGGGTCTGAGGGGTATTGGGG + Intronic
947941886 2:234064108-234064130 GGAGGGGCAGAGGGGAGGGGAGG - Intronic
948117176 2:235502062-235502084 TGAGGGGCTGAGGGGGATTTGGG + Intronic
948205453 2:236160639-236160661 GGACGGGCTCAGGGGCACAGGGG + Intergenic
948363618 2:237439873-237439895 GGAGGGGCAGAGGGAAGATGAGG - Intergenic
948660817 2:239505531-239505553 GGAGGGGCAGAGGGGCGGTGCGG - Intergenic
948690961 2:239704880-239704902 GTGGGTGCCGAGGGGAACTGTGG - Intergenic
948693438 2:239720972-239720994 GGAGGTTTGGAGGGGAACTGGGG + Intergenic
948981266 2:241496100-241496122 GGAGGGGCAGAGGCCAGCTGAGG + Intronic
1169251307 20:4063451-4063473 GGAGGGTTTGAGGGCAGCTGTGG + Intergenic
1169266107 20:4168135-4168157 GGAGGGGGCATGGGGAACTGAGG + Intronic
1170415407 20:16133746-16133768 AGAGGGGCTGGGGGGAGCTTTGG + Intergenic
1170467907 20:16639592-16639614 GCAGACCCTGAGGGGAACTGAGG - Intergenic
1170602070 20:17848852-17848874 GGAGGGGCAGCTGGGAGCTGAGG + Intergenic
1170783504 20:19448091-19448113 GGAAGGGATGACTGGAACTGTGG - Intronic
1170979260 20:21195843-21195865 GGTGGGGCTGTGGAGAGCTGGGG - Intronic
1171285786 20:23937234-23937256 GGAGGGTGTCAGGGGAACTAAGG + Intergenic
1171393726 20:24817609-24817631 GGTGGGGCTGAACGGACCTGGGG - Intergenic
1171468934 20:25354343-25354365 GGAAGGTCTGGGGAGAACTGGGG + Intronic
1171473507 20:25390417-25390439 GGAGGGGCTGGGAGGTACCGCGG + Intronic
1171517774 20:25751158-25751180 GGCGGGGCTGAGGGGAGGGGTGG + Intergenic
1172133469 20:32671887-32671909 CCAGGGGCTGAGGGGGAGTGGGG + Intergenic
1172579316 20:36034284-36034306 GGAGGTCTTGAGGGGAGCTGAGG + Intergenic
1172772001 20:37387301-37387323 AGAGGGGCAAAGGGGAACAGAGG + Intronic
1173166288 20:40689129-40689151 GGTGGGGCTGAGGGGAGGCGTGG + Exonic
1173626312 20:44475739-44475761 GGAGTGGCTGGGAGGAGCTGGGG - Intergenic
1174231198 20:49046666-49046688 GTGAGGGCTGAGGGCAACTGAGG + Intronic
1174287032 20:49481104-49481126 GCAGGGGCTGTAGGGGACTGAGG - Intronic
1174409202 20:50322597-50322619 GGAGAGGGTGATGTGAACTGAGG - Intergenic
1174473901 20:50782419-50782441 TGAGGGGCTGAGGTGAATGGAGG - Intergenic
1175891216 20:62316851-62316873 GCTGGGGCTGAGGGGAAGTGAGG + Intronic
1175891522 20:62318048-62318070 GGAGGGGGTGAGGAGAGATGGGG + Intronic
1175958653 20:62624056-62624078 GGCGGGGCTGTGGGGAGCAGTGG + Intergenic
1176086237 20:63296828-63296850 GCAGGGGCTGGGGGGCACTGGGG - Intronic
1176106556 20:63392260-63392282 GCAGGGGCTGGGGGGCACTGGGG + Intergenic
1176242260 20:64080465-64080487 TGCGGGGCTGGGGAGAACTGGGG + Intronic
1176371174 21:6062063-6062085 GCAGGGGCTGTGAGGAGCTGAGG - Intergenic
1178902077 21:36606087-36606109 GGAGGGGCTGGGTGGGTCTGGGG + Intergenic
1179192201 21:39133172-39133194 GGAGGGGCTGAGGTGAGCCGAGG + Intergenic
1179626596 21:42652926-42652948 GGAGGAGCCCAGGAGAACTGGGG + Intergenic
1179752345 21:43476478-43476500 GCAGGGGCTGTGAGGAGCTGAGG + Intergenic
1179909466 21:44440408-44440430 GGAGGAGCTGGGGGTGACTGGGG - Intronic
1179996465 21:44976621-44976643 TGAGGGGCTGAGGGGTCCGGGGG + Intronic
1180041371 21:45282066-45282088 GGAGGGGCTGAGCTGGGCTGGGG - Intronic
1180090973 21:45533711-45533733 GCAGGGGCTGAGGTCACCTGGGG - Intronic
1180184492 21:46132721-46132743 GGAGGGCCTGGGGAGACCTGGGG - Exonic
1180886106 22:19245164-19245186 GGAGGGGGAGAGGGGAACATGGG - Intronic
1180956543 22:19743818-19743840 GGATGGGCAGAGGGGGGCTGTGG - Intergenic
1181162614 22:20967140-20967162 GGAGGGGCTGGGGGGCGGTGTGG - Intronic
1181277391 22:21695344-21695366 GGAGGGGCTGAGGGAGGGTGTGG + Intronic
1181357007 22:22304123-22304145 CAAGGGGCTGAGAGGAACTGAGG - Intergenic
1181577047 22:23801875-23801897 TGAGGGGGTGAGGGCAGCTGAGG - Intronic
1181703665 22:24634791-24634813 GGAGGGGCTGCGGGGGGCGGTGG - Intergenic
1182446447 22:30392556-30392578 GGAGGGCCGGAGGGGTGCTGGGG - Intronic
1182714140 22:32341385-32341407 GGAGGGGCTGAGGGGAACTGGGG - Intergenic
1183198201 22:36367846-36367868 GGAGGGGAGGAGGGGGCCTGGGG - Intronic
1183303780 22:37071196-37071218 GGAGGGGCTGTGGGGGGCGGGGG - Intronic
1183306528 22:37085909-37085931 GGAGGGGGTGAGGGGCAGAGGGG + Intronic
1183349208 22:37325222-37325244 GGAGGGGAGGAGGGAAACTGAGG + Intergenic
1183376988 22:37471176-37471198 GGAGGGCATGAGGTGAACTCTGG - Intronic
1183568236 22:38632115-38632137 TGAGAGCCTGAGGGGCACTGAGG + Intronic
1183700873 22:39450302-39450324 GGAGGAGCTGTGGGTACCTGGGG + Intergenic
1184046642 22:41976536-41976558 GGAGGGGCGCAGGGGACCAGTGG - Intronic
1184111939 22:42400781-42400803 GGAGGCACTGAGGTGCACTGGGG - Intronic
1184248913 22:43249302-43249324 GGCGGGGTGGAGGGGAGCTGGGG + Intronic
1184401456 22:44276975-44276997 GGAGGGGCTGAGGGGAACTGGGG - Intronic
1184562089 22:45269218-45269240 GGCGGGGCTGAGAGGAGGTGGGG + Intergenic
1184645168 22:45891442-45891464 GCAGAGGATGAGGGGGACTGAGG - Intergenic
1184853910 22:47136268-47136290 AAAGGGGCTGTGGGGACCTGGGG - Intronic
1184940670 22:47762345-47762367 AGAGGACCTGAGGGGCACTGCGG - Intergenic
1184994821 22:48197715-48197737 GAGGGGGCTTAGTGGAACTGGGG + Intergenic
1185219131 22:49620402-49620424 GGCTGGGCAGGGGGGAACTGGGG - Intronic
1185253978 22:49821807-49821829 GGAGGGTCTGTGTGGTACTGGGG + Intronic
1185313507 22:50169532-50169554 GGCGGGGCTGTGGGGAGCGGAGG + Intergenic
1185336796 22:50274624-50274646 AGAGGTGCTGAGGGGAGGTGGGG - Intergenic
949599345 3:5581278-5581300 GGAAGGTGTGAAGGGAACTGAGG + Intergenic
950100474 3:10353512-10353534 GGAGGGGCTGAGGGAAGATGTGG + Intronic
950115401 3:10447524-10447546 GGAGAAGCTGATGGGCACTGTGG - Intronic
950206058 3:11082058-11082080 GGAGAGGCTGAGGGAACCTTTGG + Intergenic
950416621 3:12872603-12872625 GGAGGGGGTGATGGGAATGGGGG + Intergenic
950785135 3:15427898-15427920 GGAGCGGCCGAAGGGAACCGTGG - Intronic
952881644 3:37989589-37989611 GGGTGGGCTGAGGGGAGATGGGG + Intronic
953056099 3:39388336-39388358 GCAGGGGGTGGGGGGAACTAAGG - Intronic
953148945 3:40306489-40306511 GGAATGGCTGATGGGAAGTGTGG + Intergenic
953385393 3:42503052-42503074 GGAGGGGCAGCGGGGAAGAGTGG + Intronic
953536863 3:43783234-43783256 GGAGGAGATGAGGGGCACAGAGG + Intergenic
953929662 3:46999601-46999623 GGATGGGTTGGGGGGACCTGAGG - Intronic
954025847 3:47782294-47782316 GGAGGGCCTGAGGGAAAGCGGGG - Intergenic
954375526 3:50192352-50192374 AGAGGGGCTGGCGGGTACTGAGG + Intronic
954380840 3:50218254-50218276 GGAGGGGCTGTGGGGAAGTGGGG - Exonic
954529222 3:51304048-51304070 TGAGGGGCTGCGGAGACCTGCGG - Intronic
954795150 3:53157594-53157616 GGACAGGCTGAGGGGGACAGTGG - Intronic
955358361 3:58250596-58250618 GTGGTGGCTGAGGGGAGCTGCGG + Intronic
956698627 3:71939678-71939700 AGTGGAGCTGAGAGGAACTGTGG + Intergenic
956728547 3:72176786-72176808 GGTGTGTCTGTGGGGAACTGGGG + Intergenic
957270973 3:78029934-78029956 GGAGGCGCAGACGGGAACCGGGG + Intergenic
960646655 3:119892554-119892576 GGATGGGAGGAGAGGAACTGAGG - Intronic
961073957 3:123964225-123964247 GGAGGGGATGAGGGGACCTAAGG + Intergenic
961309663 3:125987904-125987926 GGAGGGGATGAGGGGACCTAAGG - Intergenic
961433900 3:126903065-126903087 GGATATTCTGAGGGGAACTGGGG + Intronic
961572399 3:127809142-127809164 GTAGGGAGTGAGGGGAATTGGGG + Intronic
961803008 3:129467163-129467185 GCAGGGACTAGGGGGAACTGTGG + Intronic
961957112 3:130815340-130815362 GGAGGCGCTGAGAGCAAGTGAGG + Intergenic
962162412 3:133013237-133013259 GGAAGTGCAGAGGGGAAATGAGG + Intergenic
962993508 3:140602105-140602127 GTAGAGACTGTGGGGAACTGAGG - Intergenic
964222718 3:154365273-154365295 GGAGGGGCCCAGGGCACCTGTGG - Intronic
964368118 3:155970906-155970928 GGTGGGCCTGAGGGGTGCTGTGG + Intergenic
964376230 3:156051780-156051802 AGAGGCGCTGGTGGGAACTGGGG + Intronic
964745848 3:160011609-160011631 GGGTGGGGTGAGTGGAACTGAGG - Intergenic
965049443 3:163626792-163626814 GGCAGTGCTGAGGGGAAATGTGG + Intergenic
965191589 3:165537324-165537346 TGATGGGTTGAAGGGAACTGGGG + Intergenic
965232457 3:166071440-166071462 GGTAGTGCTGAGGGGAAATGTGG - Intergenic
965514704 3:169608488-169608510 GGAGGGGATGTGGGGAAATGTGG - Intronic
966233033 3:177670475-177670497 GAAGGGGTTGAGGGGTAGTGAGG + Intergenic
966629600 3:182057852-182057874 TGAGAGGCTGAGGGGTGCTGTGG - Intergenic
967561980 3:190926779-190926801 GGAGGGGCTGAGGTGTTCTCAGG + Intergenic
967877580 3:194277434-194277456 GGAGGGGAAGAGGGGAAGGGAGG + Intergenic
968142200 3:196267359-196267381 GGAGAGACTGGGGGGAAATGGGG + Intronic
968378677 4:68882-68904 TGAGGGGTTCAGGGGAAGTGGGG - Intronic
968622033 4:1608201-1608223 GGAGGGGCTGAGGAGACCAGGGG - Intergenic
968629271 4:1641820-1641842 GCGGGGGCTGAGGAGAGCTGAGG - Intronic
968808280 4:2788728-2788750 GGAGGGGCAGAGGGGGTGTGGGG - Intergenic
968820123 4:2843885-2843907 GGAGGGGCTGAGGGGCGGAGAGG + Exonic
969086820 4:4662765-4662787 GGAGGGGCTGAGCTGGAATGGGG + Intergenic
969454805 4:7294936-7294958 GGAGGGGGAGGGGGGAGCTGGGG - Intronic
969839875 4:9873389-9873411 GGAGGGGCTGCAAAGAACTGTGG - Intronic
970222008 4:13821278-13821300 AGAGGGGAGAAGGGGAACTGGGG - Intergenic
971209984 4:24606917-24606939 GCAGGGGCTGAGGAGAAAGGGGG + Intergenic
971502592 4:27332897-27332919 GGAGGGTGTCAGGAGAACTGGGG - Intergenic
973309061 4:48687468-48687490 GGAGGGCCTCAGGGCAAATGAGG + Intronic
973663576 4:53134167-53134189 GGCTGGGGTGAGGGGAACTGGGG + Intronic
974833414 4:67216462-67216484 GGAGGGGGGGAGGGGAAGGGAGG + Intergenic
974899824 4:67983472-67983494 GGAGGAGCTCATGGGAAATGTGG - Intergenic
975006667 4:69297014-69297036 GGAGGGACTGGGTGGAGCTGAGG - Intronic
976493150 4:85694635-85694657 GGAGGGGCCGAGGGAAAGTCAGG - Intronic
976971081 4:91103550-91103572 GGAGGGACTGGCTGGAACTGTGG + Intronic
976988036 4:91327161-91327183 GGAAGTGCAGAGGGGAAATGTGG - Intronic
977131122 4:93238609-93238631 GCAGGGGGTGAGGGGAAATTAGG + Intronic
977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG + Intronic
979629557 4:122884814-122884836 GGAGGTGCTGGGGGGATGTGAGG + Intronic
979822528 4:125191953-125191975 AGAGGCGCAGGGGGGAACTGGGG + Intergenic
979895385 4:126149910-126149932 GAAGGGGTTGAGGGGTAGTGAGG + Intergenic
980467328 4:133202917-133202939 GAAGGGGCTGAGGAGAGGTGAGG + Intronic
980544739 4:134244446-134244468 AGGGAGGCTGAGGGGGACTGAGG + Intergenic
981300850 4:143184840-143184862 GGAGGGGCGGAGGGGCAGAGGGG + Intergenic
981418532 4:144521555-144521577 GGAGAGGTGGAGGGGAAGTGAGG - Intergenic
982911132 4:161144307-161144329 GGCAGTGCAGAGGGGAACTGTGG + Intergenic
983340519 4:166454899-166454921 GGAAGTGCAGAGGGGAAATGTGG + Intergenic
983957869 4:173717952-173717974 GGAGGTGCTGAGAGCAAGTGAGG + Intergenic
983999842 4:174226537-174226559 GCAGAGGCTGAGGAGCACTGGGG + Intergenic
984157102 4:176206647-176206669 GGAGGTGCTGGGGGATACTGTGG - Intergenic
984241903 4:177228034-177228056 GGAGGCGCTGAGAGCAAGTGAGG + Intergenic
984727580 4:183036261-183036283 GAAAGGGCTGTGGGGATCTGAGG + Intergenic
984845899 4:184107447-184107469 GCAGGGGCAGAGGCAAACTGGGG + Intronic
985998731 5:3613413-3613435 GCAGGGGCTGAGGGCCACAGAGG - Intergenic
986082623 5:4410031-4410053 GCAGGGGCCGGGGGGAGCTGTGG + Intergenic
986266368 5:6194827-6194849 AGAGGGGCCGAGGGGGACAGGGG - Intergenic
987870790 5:23614396-23614418 GGAAGTGCAGAGGGGAAATGTGG + Intergenic
988003001 5:25373331-25373353 ACAGGGGTTGAGGGGAAGTGAGG + Intergenic
988360950 5:30235510-30235532 GCAGAGGCTGATGGTAACTGAGG - Intergenic
988537992 5:32086155-32086177 GCAGGGGCTGAGGCTAACTAGGG - Intronic
988738262 5:34044420-34044442 GGAGGCACTGTGGGAAACTGAGG + Intronic
988934293 5:36066936-36066958 GGAGGGGCAGAGGGCAAGAGGGG - Intronic
989027817 5:37087347-37087369 GGTGGGGCTGAGGGAAAAGGAGG - Intergenic
989229055 5:39066039-39066061 GGTGGGGCCAAGGGGAAATGTGG - Intronic
989673391 5:43946281-43946303 GGAAGTGCAGAGGGGAAATGTGG - Intergenic
990008026 5:50965596-50965618 GAAGGGGCTGCGGGGGAGTGTGG + Intergenic
990988177 5:61660157-61660179 GGAGGGGCAGAGGGGAATGGTGG + Intronic
991607942 5:68422087-68422109 CTAAGGGCAGAGGGGAACTGTGG + Intergenic
992487423 5:77210371-77210393 GGAGGGGCGGAGGGGCGCAGTGG + Intergenic
992661448 5:78965460-78965482 GGAGGGACTAGGGGGAAATGGGG + Intronic
992888377 5:81181756-81181778 GGAAGGGAGGAGGGGAGCTGAGG - Intronic
994285180 5:97956002-97956024 GGAAGTGCAGAGGGGAAATGTGG + Intergenic
994644660 5:102453252-102453274 AGGGGGGCTGAGGGAGACTGAGG + Intronic
996681118 5:126228955-126228977 GGAGGTGCTGAGAGCAAGTGAGG - Intergenic
996762921 5:127003975-127003997 GGAGTGGCTGAGGGAGGCTGGGG + Intronic
996906027 5:128601402-128601424 AGTGGGGCTGGGGGGAAGTGGGG - Intronic
996906039 5:128601431-128601453 AGTGGGGCTGGGGGGAAGTGGGG - Intronic
997526264 5:134555133-134555155 GGAGGGACAGAGGGGGCCTGGGG - Intronic
997537312 5:134632812-134632834 GAAGGGGCTGATGCGAACTGGGG - Exonic
997833071 5:137169194-137169216 TGAGGGGTTGGGGGGAAGTGGGG + Intronic
998013818 5:138716576-138716598 GGTGGGGCTGAGAGGATGTGGGG + Intronic
998064550 5:139147420-139147442 GCTGGGGTTGAGGGGAAATGTGG + Intronic
998130643 5:139649616-139649638 GGAGGGGCCGCGGGGCACCGTGG - Intronic
998154358 5:139776051-139776073 GGAGGGGTTCAGGGGCCCTGGGG + Intergenic
998490086 5:142539401-142539423 GGAGGGGAGGAGGGGAAAAGAGG - Intergenic
998668410 5:144325480-144325502 GGAGGGGGAGAGGGCAAGTGAGG - Intronic
998767020 5:145499633-145499655 GCAGGGCCTGAGGGAAGCTGTGG + Intronic
999093638 5:148958830-148958852 GGAGGTGCTCACGGGAACTGGGG - Intronic
999400828 5:151263052-151263074 GAAGGAGCAGAGGGGATCTGAGG - Intronic
999545992 5:152629222-152629244 GGAGTGGGGGAGGGGAAGTGGGG - Intergenic
999900608 5:156082377-156082399 TAAGGGGCTGAGAGGCACTGGGG - Intronic
1000285304 5:159821360-159821382 GGTGGGACTGTGGGGTACTGAGG - Intergenic
1000345610 5:160311697-160311719 GGAGTGTCTGAGCGGAATTGGGG - Intronic
1000674609 5:164105556-164105578 GGGAGGGCAGAGGGGAAATGTGG + Intergenic
1001956936 5:175854125-175854147 GTAGGGGCTCAGGGGTGCTGGGG - Intronic
1001960934 5:175880143-175880165 AGAGGGGCAGAGGCCAACTGAGG - Exonic
1002158209 5:177299511-177299533 AGAGGGGCAGAAGGGAGCTGAGG - Exonic
1002162032 5:177320077-177320099 AGAGGGAGGGAGGGGAACTGTGG - Intergenic
1002493523 5:179596722-179596744 GGAGGGACTGGGAAGAACTGGGG + Intronic
1002582365 5:180216470-180216492 GGAGGTGCTGCAGGGAGCTGTGG + Intergenic
1002807578 6:591843-591865 GGAGGCCCTGAGGGAAGCTGGGG - Intronic
1003318926 6:5035589-5035611 GGAGGGGAGGAGGGGAAGGGAGG - Intergenic
1003318960 6:5035659-5035681 GGAGGGGAGGAGGGGAAGGGAGG - Intergenic
1003866555 6:10368648-10368670 GCAGAGGCTGGTGGGAACTGGGG - Intergenic
1003874587 6:10424472-10424494 GGAGTGGCGCTGGGGAACTGGGG - Intergenic
1003942723 6:11044498-11044520 GGAGGGGCGCAGGGCAAGTGAGG + Intergenic
1004148912 6:13096151-13096173 AGGAGGGGTGAGGGGAACTGTGG - Intronic
1004436363 6:15598687-15598709 GGTGGGGTTGAGGGGGATTGGGG + Intronic
1004516372 6:16325567-16325589 GGAGGGAGTGAGGGGAAATGTGG - Intronic
1004663277 6:17728763-17728785 AGAGGCGCCGCGGGGAACTGGGG + Intergenic
1006011377 6:31045492-31045514 GGAGGGAGTGCAGGGAACTGAGG + Intergenic
1006022164 6:31123694-31123716 GGAGGGGTGGAGGGGACCAGAGG - Intronic
1006301331 6:33194918-33194940 GATGGGGCTGGGGGGCACTGAGG - Intronic
1006377349 6:33678845-33678867 GGCGGGGCTGAGGGGTGCTCAGG + Intronic
1006634516 6:35452473-35452495 TCAGAGGCTGAGGGGAACGGAGG - Exonic
1007371093 6:41427593-41427615 GGAGGGGCGAAGGGGAAGTTGGG - Intergenic
1007392391 6:41557214-41557236 GAAGGAGCTGAGGAGAATTGAGG + Intronic
1007496118 6:42261139-42261161 AGAGGGGCTGAGGAGAATGGGGG + Intronic
1007835660 6:44671807-44671829 GGAGGGGGAGAGAAGAACTGAGG - Intergenic
1008368087 6:50705927-50705949 GGAGAGGCTAAGGGTAAATGTGG + Intergenic
1008385118 6:50880362-50880384 GGAGGGGAGGAGGGGAAAGGAGG - Intergenic
1009469292 6:64012031-64012053 GGAGGGGGTGAGGGGACAAGAGG - Intronic
1009667711 6:66705063-66705085 GGAGGTGCTGAGAGCAAGTGAGG + Intergenic
1011873257 6:91923868-91923890 GGAGGGTTGGAGGGGAAGTGGGG + Intergenic
1012044475 6:94252633-94252655 GGAACGGCTGAGGGGAATTAGGG - Intergenic
1012131219 6:95496796-95496818 GGAGGTGCTGAGAGGCAGTGAGG - Intergenic
1012273263 6:97240965-97240987 TGAGGGCCTGAGGGGAATGGTGG - Intronic
1013611983 6:111804286-111804308 GGGGGAACTGGGGGGAACTGGGG + Intronic
1016172994 6:141042056-141042078 GGAGGTGCTGAGAGCAAGTGAGG + Intergenic
1017000377 6:149992385-149992407 GGAAGGGCTGAGGTGGACAGTGG + Intergenic
1017163821 6:151390367-151390389 CGAGGGGCTGAGGGGGAGGGAGG + Intronic
1018266604 6:162030901-162030923 GGAGGGGCTGGAGTGAGCTGAGG - Intronic
1018930842 6:168239412-168239434 GCAGGGGCTGAGGGGAAGGCTGG + Intergenic
1019112054 6:169724391-169724413 GGCGGGGCTGAGGCGAGCGGCGG - Intronic
1019112059 6:169724409-169724431 GGCGGGGCTGAGGCGAGCGGCGG - Intronic
1019112064 6:169724427-169724449 CGCGGGGCTGAGGGGAGCGGCGG - Intronic
1019306478 7:337722-337744 GGAGGAGCGGAGGGGAAGTCAGG + Intergenic
1019494659 7:1332147-1332169 GGAGGGGCTGGGAGGAGCGGGGG + Intergenic
1019614525 7:1953104-1953126 GGAGGGGGTGAGGAGGTCTGAGG + Intronic
1019656313 7:2197961-2197983 GGAGGGGCTGATGGGCCCTGTGG - Intronic
1020101989 7:5399103-5399125 GGTGGGGCAGGGGGGCACTGTGG - Intronic
1021343171 7:19489285-19489307 AGGGAGGCTGAGGGGGACTGAGG - Intergenic
1023217348 7:37877790-37877812 GGTGGGGCAGAGGGGAAGGGGGG - Intronic
1023222099 7:37930002-37930024 GGGGGGACTGAGGGTAACTTAGG - Intronic
1024212647 7:47218854-47218876 GGATGGGGTGAGGGGCACAGAGG - Intergenic
1024926308 7:54619038-54619060 GGAAGTGCTGAGGGGAAATGTGG - Intergenic
1025048373 7:55712563-55712585 GGATGGTCTGAGGGCAACTCAGG + Intergenic
1025790100 7:64680920-64680942 GGAGGGGCTGCTGGGCGCTGCGG - Intronic
1026228439 7:68462883-68462905 GGAGGGGGGGAGGGGAAGAGAGG - Intergenic
1026447107 7:70494556-70494578 GGAGGGGCGGTGGGGACGTGGGG - Intronic
1026913578 7:74106789-74106811 TGAGGGGTTGAGGGGAGCTGGGG + Intronic
1027051923 7:75026021-75026043 GGAGGGGGTGAGGGAACCCGAGG + Intergenic
1027146556 7:75699672-75699694 GGTGTGGCTGAGGGGAAGAGAGG - Intronic
1027228521 7:76259768-76259790 GGAGGGGCGAGGGGTAACTGCGG - Intronic
1027619868 7:80471127-80471149 GTACCAGCTGAGGGGAACTGAGG + Intronic
1028478902 7:91282989-91283011 TGAGGGGCTGAGGGGAAATGGGG - Intergenic
1028523040 7:91753040-91753062 AGAGGGGCTGTGCTGAACTGTGG - Intronic
1028696989 7:93725613-93725635 GGAGAGACTGAGTGGAAATGAGG - Intronic
1029120033 7:98261607-98261629 GGGAGTGCTGAGGGGAAATGTGG - Intronic
1029422417 7:100478175-100478197 GGAGGGCCTGGCGGGAACCGGGG + Exonic
1029539456 7:101174126-101174148 GGAGGAGCTAAGAGGAAGTGGGG - Intronic
1030215754 7:107042675-107042697 AGAGGCGCGGACGGGAACTGGGG - Intergenic
1030748086 7:113193368-113193390 TGAGGGGCTGAGGGTATGTGGGG - Intergenic
1030778640 7:113569009-113569031 GGAGGGGGTCAGGAGAAGTGAGG - Intergenic
1031193851 7:118588246-118588268 GGCAGTGCTGAGGGGAAATGTGG - Intergenic
1032069072 7:128792532-128792554 AGAGGGGCTAAGATGAACTGAGG - Intronic
1032505472 7:132431312-132431334 GGAGGGGGAGAGGGGAGGTGGGG - Intronic
1033165930 7:139038671-139038693 GGTGTGGCTGTGGGCAACTGGGG - Intergenic
1033478696 7:141716483-141716505 GGAGGGGAGGAGGGGAGATGGGG - Intronic
1034416326 7:150966111-150966133 AGGGGGGCTGAAGGGGACTGAGG - Intronic
1034701378 7:153099214-153099236 GGGGAGGCTCAGGGGAACTTTGG + Intergenic
1035464006 7:159063731-159063753 GGAGGGCCTGGCGGGATCTGGGG + Intronic
1036135029 8:6152710-6152732 AGAGGCGCGGACGGGAACTGGGG + Intergenic
1036520240 8:9484980-9485002 GGAGGGGATGACTGGAACAGAGG + Intergenic
1036701981 8:11019010-11019032 GGAGTGGGTGAGGGGGCCTGAGG - Intronic
1037240656 8:16773451-16773473 GAAGGGGCTGAGGGTATGTGTGG - Intergenic
1037693567 8:21204609-21204631 GGAGGTGCTGAGGAGAAGAGTGG + Intergenic
1037704651 8:21309104-21309126 GCAGGGGATGAGGGGAGCAGAGG - Intergenic
1037915269 8:22769168-22769190 GGGGGCACTGAGGGGCACTGAGG - Intronic
1037980142 8:23247181-23247203 GGAGAGGAAGAGGGGATCTGGGG + Intronic
1038149290 8:24928100-24928122 GGGGAAGCTGAGGGGAGCTGAGG + Intergenic
1038319079 8:26512338-26512360 GGAGGGGCTGAGAGAACCGGAGG - Intronic
1038641683 8:29333995-29334017 GGAGGGAATGATGGGAGCTGGGG + Exonic
1038697176 8:29817128-29817150 GGAGGGGGTGAGGAGAATTTAGG - Intergenic
1038912022 8:31975360-31975382 GGAGGTGAGGATGGGAACTGGGG + Intronic
1039452707 8:37688484-37688506 GGAGGGGCTGAGGTTTCCTGTGG + Intergenic
1039610643 8:38916395-38916417 TGGGGGGCTGGGGGGAAATGGGG - Intronic
1039954199 8:42194932-42194954 GGAGAGGCAGATGGAAACTGGGG - Intronic
1040433882 8:47370863-47370885 GCAGGGGCTACAGGGAACTGTGG - Intronic
1040723051 8:50349771-50349793 GGAGGTGCTGAGAGCAAGTGAGG - Intronic
1041021592 8:53643698-53643720 GGAGGGGCTGAGGTGTAGAGAGG - Intergenic
1041095242 8:54343131-54343153 GGAAGGGCTGAGGGGAGAGGAGG - Intergenic
1041700076 8:60778919-60778941 AGAGGGGCAGAGGGTAACTTTGG + Intronic
1043138480 8:76558110-76558132 GGAGGGGCCCAGGGCATCTGTGG + Intergenic
1043855725 8:85262713-85262735 GGAGTGGCTAAGGGGAGCTTTGG + Intronic
1043912417 8:85878391-85878413 GGAGGGGCAGAGGGGCACAAAGG - Intergenic
1044862225 8:96534321-96534343 GGAGGTGCTGAGAGCAAGTGAGG + Intronic
1045331562 8:101159749-101159771 GGAGGGGCTGATGAGAATTTTGG + Intergenic
1045811492 8:106225157-106225179 GGAAGGGTGGAGGGGAATTGAGG + Intergenic
1046236908 8:111436161-111436183 GGTGGGGCTGTGGAGAACAGGGG - Intergenic
1047927775 8:129697992-129698014 GGAGGGGGTAAGGGAAAATGGGG - Intergenic
1048007687 8:130432156-130432178 GGAGGGGAGGAGGGGAAAGGGGG + Intronic
1048661564 8:136608780-136608802 GAAAGGGTTGTGGGGAACTGGGG + Intergenic
1048886580 8:138914249-138914271 CGAGGGGCTGCGGGGAAAGGTGG + Intergenic
1049510952 8:143026408-143026430 GGAGGGGCTGCGGTGAAGAGAGG + Intergenic
1049638914 8:143705535-143705557 GGAGGTGCTGGGGGGGACTGGGG + Intronic
1049737755 8:144218801-144218823 GGAGGGGAGGAGGGGAGGTGAGG - Intronic
1049779849 8:144423953-144423975 TGAGGGCCTCAGGGGCACTGCGG + Exonic
1049970971 9:821637-821659 TTAGGGGTTGAGGGGAAATGGGG - Intergenic
1051589533 9:18762626-18762648 TGAGGGGCTGAGGGGGAGGGTGG - Intronic
1052603520 9:30670926-30670948 GCAGGGGTTGAGGGGACCAGGGG - Intergenic
1053123235 9:35561114-35561136 GGAAGGGCTGAGGGGGGCGGGGG + Intronic
1053157733 9:35792130-35792152 GGAGGGACCGAGGGGGCCTGCGG - Intergenic
1053415037 9:37942119-37942141 AGAAGAGCTGAGGGGCACTGGGG - Intronic
1053689698 9:40578153-40578175 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1053818116 9:41935916-41935938 GGAGGGGATGGGAGGAACTGAGG - Intronic
1054300945 9:63379092-63379114 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1056388219 9:86116846-86116868 GGAGGAGCTGGGGGGAGCAGAGG + Intergenic
1056615281 9:88160237-88160259 GCAGGGGCTGGAGGGAGCTGGGG - Intergenic
1057145668 9:92757589-92757611 GGGGGGGCGGGGGGGAGCTGAGG + Intronic
1057183083 9:93040264-93040286 GGAGGTCCTGAGGGGAAGGGTGG - Intergenic
1057262106 9:93590801-93590823 AGAGGGGCTGAGGAGACGTGAGG - Intronic
1057478817 9:95427703-95427725 TGCGGGGCTGAGGGGAGGTGTGG + Intergenic
1057694991 9:97316913-97316935 GCAGGGCCTGAAGGGGACTGAGG - Intronic
1059383098 9:113943754-113943776 AGAGGGGATGAGGGGGACTGAGG + Intronic
1059414989 9:114156738-114156760 GGAGCGGCTGCGCGGAGCTGGGG + Intronic
1059419664 9:114183159-114183181 GGAGGGCTTCAGGGGAACTGAGG + Intronic
1059623204 9:116032103-116032125 GGAGGGTCTGAGGAGGGCTGGGG - Intergenic
1059908160 9:119011724-119011746 GCAGGGGGACAGGGGAACTGAGG + Intergenic
1060103582 9:120860027-120860049 GGAGGGGCTGAGAGGAATGATGG + Intronic
1060210351 9:121706568-121706590 GGAGGGGCAGAGAGGAACCACGG - Intronic
1060256448 9:122035146-122035168 GGTGGGCTTGAGGGGAACAGAGG - Intronic
1060427514 9:123519026-123519048 GGAGGGACCGAAGGGAACGGGGG - Intronic
1060892090 9:127195393-127195415 GGAGGAGCTGAGGGGCACTGTGG + Intronic
1060935083 9:127510004-127510026 GGAGGGGCTGCTGGGGACTAGGG - Intronic
1061387027 9:130296415-130296437 GCCGGGGCTGAGGCGAGCTGAGG + Intronic
1061631323 9:131874086-131874108 GTGGGGGCTGAAGGGAAATGCGG - Intronic
1061782490 9:133004218-133004240 GGCCGGGCTGAGGGGCGCTGGGG - Intergenic
1061874213 9:133535849-133535871 GGAGGGGGTGGGGAGAGCTGAGG + Intronic
1061970500 9:134042191-134042213 GGAGTTGCTGAAGGGAGCTGTGG - Intronic
1062001197 9:134216582-134216604 CGAGGGGCTGAGCGGCTCTGAGG - Intergenic
1062194098 9:135263799-135263821 GGAGGGGGTGAGGGGAGGGGTGG - Intergenic
1062246546 9:135570783-135570805 GGAGGGGCAGAGGAAAAATGTGG - Intergenic
1062278559 9:135741962-135741984 AGAGAGGCTGATGGGAGCTGAGG - Intronic
1062388916 9:136326477-136326499 GGAGGGGCTGGGGTGCACGGAGG + Intergenic
1062433120 9:136534877-136534899 GGAGGGACTGGGGGGCTCTGTGG - Intronic
1062433146 9:136534945-136534967 GGAGGGACTGGGGGGCTCTGTGG - Intronic
1062464199 9:136674006-136674028 GGAGGGGCTGTGGGGGGCTGGGG - Intronic
1062501827 9:136855037-136855059 GGAGGCGCCGAGGGGAGCTGGGG + Exonic
1062583297 9:137237663-137237685 GCAGGGGCAAAGGGAAACTGAGG - Intergenic
1062690164 9:137837530-137837552 AAGGGGGCTGAGGGGACCTGCGG + Intronic
1185566549 X:1099539-1099561 GGCGGGGCTGAGGGCACCTGGGG - Intergenic
1186498558 X:10032188-10032210 GGAGGGGAGGAGGGAACCTGAGG + Intronic
1186525578 X:10245062-10245084 GGAGGCTCTGAGAGGGACTGAGG - Intergenic
1186785800 X:12955154-12955176 GGAAGGGGTGAGGGGAAGTAGGG - Intergenic
1187424269 X:19162877-19162899 TGAGGGGCTGCGAGGGACTGTGG + Intergenic
1187581857 X:20615609-20615631 GGAGGGGCAGGGAGGAAGTGAGG + Intergenic
1188971851 X:36627444-36627466 GGAAGGGCAGTGGGGAGCTGGGG - Intergenic
1188972070 X:36630050-36630072 GGAAGGGCAGTGGGGAGCTGGGG - Intergenic
1189149198 X:38686994-38687016 GGAGGGGCTAGGGGAAAGTGGGG - Intronic
1189485898 X:41431472-41431494 AGCGGAGCTGAGGGGACCTGGGG - Intergenic
1189750168 X:44212555-44212577 GGAGGGGAGGGGAGGAACTGAGG + Intronic
1190328463 X:49221178-49221200 GGAGGGGCAGTGGGGAAGAGCGG - Intronic
1190333150 X:49248009-49248031 GGAGGGTCTGTGGGCATCTGTGG + Intronic
1190711326 X:53072844-53072866 GCAGGGGCTGAGCAGAAATGGGG - Intronic
1191110849 X:56802395-56802417 AGGGTGGCTTAGGGGAACTGGGG - Intergenic
1191995849 X:67094545-67094567 GGCAGGACTGAGGGGAAATGTGG + Intergenic
1192359130 X:70427229-70427251 GCTGGGGCTTAGGGGATCTGGGG + Intronic
1192420260 X:71023036-71023058 GGAGGGGAGGAGGGGAAAAGAGG + Intergenic
1192501784 X:71659241-71659263 AGAGGGCGTGAGGGAAACTGGGG - Intergenic
1192550925 X:72052824-72052846 AGAGGGGCTGGGGGGAGCAGAGG - Intergenic
1193013367 X:76703928-76703950 GGAGGGGCTGAGGAAAAGTGGGG + Intergenic
1194089902 X:89572914-89572936 GGAGGGTGGGAGGGGAACTAGGG - Intergenic
1194397239 X:93401674-93401696 GGAAGTGCAGAGGGGAAATGTGG + Intergenic
1194546841 X:95246150-95246172 TGAGGAGCTGAGGGGAGGTGGGG + Intergenic
1194776048 X:97966200-97966222 GGAGAGGGTGAGAGGAAGTGAGG - Intergenic
1195126466 X:101813700-101813722 GGGGAGGCTGAGGGCAGCTGAGG + Intergenic
1195179113 X:102339646-102339668 GGGGAGGCTGAGGGCAGCTGAGG - Intergenic
1195596643 X:106698864-106698886 GGAGGGAGTGAGAGGAAATGAGG - Intronic
1196842436 X:119871169-119871191 GGAGGAGCTGAGGGGCAAGGAGG - Exonic
1197765403 X:130056747-130056769 GGAGGGGGTGAGGTGGAATGGGG + Exonic
1198051673 X:132957601-132957623 GGAGGGGCTCCGGGGAGCTCCGG - Intronic
1198238832 X:134763438-134763460 TGAGGGGCTGAGGTAAAGTGGGG - Intronic
1198533345 X:137565851-137565873 TGAGTGGCTGCGGGGAACTGGGG - Intergenic
1199916498 X:152347352-152347374 GGAGTGGTTGAGGGAAAGTGGGG + Intronic
1200210724 X:154345607-154345629 GCTGGGGCTGAGGGGTCCTGTGG + Intergenic
1200220128 X:154386485-154386507 GCTGGGGCTGAGGGGTCCTGTGG - Intergenic
1200430341 Y:3072676-3072698 GGAGGCGCAGCGGGGAGCTGGGG + Intergenic
1200442553 Y:3228968-3228990 GGAGGGTGGGAGGGGAACTAGGG - Intergenic
1201146202 Y:11066821-11066843 GGAGGGGCAGAGAGGAAGGGAGG + Intergenic