ID: 1184401984

View in Genome Browser
Species Human (GRCh38)
Location 22:44279738-44279760
Sequence GTCCCCAGGGTCCAGGGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184401975_1184401984 11 Left 1184401975 22:44279704-44279726 CCTGCTGGGCTCCTGTCTCTTCA 0: 1
1: 1
2: 2
3: 40
4: 420
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401974_1184401984 12 Left 1184401974 22:44279703-44279725 CCCTGCTGGGCTCCTGTCTCTTC 0: 1
1: 0
2: 5
3: 62
4: 578
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401969_1184401984 19 Left 1184401969 22:44279696-44279718 CCCCCGCCCCTGCTGGGCTCCTG No data
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401972_1184401984 16 Left 1184401972 22:44279699-44279721 CCGCCCCTGCTGGGCTCCTGTCT 0: 1
1: 1
2: 4
3: 73
4: 583
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401971_1184401984 17 Left 1184401971 22:44279698-44279720 CCCGCCCCTGCTGGGCTCCTGTC 0: 1
1: 0
2: 1
3: 83
4: 645
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401968_1184401984 20 Left 1184401968 22:44279695-44279717 CCCCCCGCCCCTGCTGGGCTCCT 0: 1
1: 0
2: 6
3: 74
4: 650
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401970_1184401984 18 Left 1184401970 22:44279697-44279719 CCCCGCCCCTGCTGGGCTCCTGT 0: 1
1: 0
2: 1
3: 53
4: 453
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401978_1184401984 0 Left 1184401978 22:44279715-44279737 CCTGTCTCTTCAGGTGGCCTGAA 0: 1
1: 0
2: 3
3: 17
4: 147
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data
1184401973_1184401984 13 Left 1184401973 22:44279702-44279724 CCCCTGCTGGGCTCCTGTCTCTT 0: 1
1: 0
2: 5
3: 46
4: 438
Right 1184401984 22:44279738-44279760 GTCCCCAGGGTCCAGGGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184401984 Original CRISPR GTCCCCAGGGTCCAGGGTGA CGG Intronic
No off target data available for this crispr