ID: 1184402754

View in Genome Browser
Species Human (GRCh38)
Location 22:44283299-44283321
Sequence AGGTGGGACACTTTTCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184402754_1184402764 27 Left 1184402754 22:44283299-44283321 CCAAAAGGAAAAGTGTCCCACCT 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1184402764 22:44283349-44283371 GCTCCGTGCACAATCCCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 93
1184402754_1184402761 5 Left 1184402754 22:44283299-44283321 CCAAAAGGAAAAGTGTCCCACCT 0: 1
1: 0
2: 0
3: 13
4: 168
Right 1184402761 22:44283327-44283349 TGGAGCTCAGCTGCCCACTCAGG 0: 1
1: 0
2: 3
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184402754 Original CRISPR AGGTGGGACACTTTTCCTTT TGG (reversed) Intronic
902210866 1:14903477-14903499 AGGGGGCACACTTTGCCATTGGG + Intronic
908078404 1:60546283-60546305 CTGTGGGAGACTTTTCTTTTGGG - Intergenic
909759799 1:79272345-79272367 AGTTGGGCCACTTTTCCATAAGG - Intergenic
910606666 1:89092646-89092668 AGGTGGGCATCTTTTCCCTTGGG - Intergenic
910927774 1:92413773-92413795 AGGTGTGACCCTTATCCTTATGG - Intergenic
911240605 1:95461852-95461874 AGGTAGGACTCTTTTCCCTAAGG + Intergenic
912489570 1:110054509-110054531 AGAGGGGCCATTTTTCCTTTTGG + Exonic
912559963 1:110543821-110543843 AAGTGGGACACTTTTCCACAAGG - Intergenic
917987082 1:180331761-180331783 GGTTGGGACAATTTTCCTTGGGG - Intronic
919473983 1:198011832-198011854 AGGTGTCAGAATTTTCCTTTGGG - Intergenic
919562646 1:199141089-199141111 ACTTAGGACACTTTCCCTTTGGG + Intergenic
920012169 1:202876442-202876464 AGGTGGGAGAATTTTTCTATTGG - Intergenic
920696346 1:208183810-208183832 GAGTTGGAGACTTTTCCTTTAGG + Intronic
920796010 1:209137538-209137560 ATGTGGGATCATTTTCCTTTAGG - Intergenic
922003448 1:221504148-221504170 AGGTGCCACACTCTTCCTGTGGG + Intergenic
1064735042 10:18373359-18373381 AGGTAGGACAGCTTTCCTTAAGG + Intronic
1067844431 10:49708712-49708734 ATGTGGGACAATTTTTGTTTTGG - Exonic
1068079677 10:52304824-52304846 AGGTGAGAAACTTTTATTTTGGG + Intergenic
1068588703 10:58831051-58831073 AAGTGGGACAGTTTTCCCTTTGG - Exonic
1069152219 10:64978118-64978140 AGGTGGCACTGTTTTCCTTTTGG + Intergenic
1070550374 10:77486342-77486364 TGGTGCTACACTTTTCCTTTTGG + Intronic
1072551957 10:96485883-96485905 ACATCGGACACTTTTTCTTTGGG - Intronic
1074384120 10:113003711-113003733 AGGTGAGGAACTTTTCTTTTAGG + Intronic
1074454517 10:113585786-113585808 TGGCGGGACCCTTTTCCTGTGGG - Exonic
1078016250 11:7617515-7617537 AGGTGGCACTCATCTCCTTTAGG + Intronic
1078895719 11:15595167-15595189 AGGAGGGACACATTTCCCATGGG + Intergenic
1079393855 11:20044859-20044881 AGCTGGTTCACTTTTCCCTTGGG - Intronic
1086329010 11:85734420-85734442 AGGTGACACAATTTTGCTTTTGG + Exonic
1086852828 11:91831068-91831090 TTGATGGACACTTTTCCTTTGGG - Intergenic
1087558347 11:99751520-99751542 AGGTGGGTAAATTCTCCTTTGGG - Intronic
1088212567 11:107472972-107472994 AGCTGGGGCATTTTTCCTTAGGG - Intergenic
1089103191 11:115981397-115981419 AGACAGGCCACTTTTCCTTTGGG + Intergenic
1094316859 12:29145230-29145252 AGGTAGGTTTCTTTTCCTTTCGG - Intergenic
1095800336 12:46265767-46265789 AGGTGGAACAGCTTTCCTGTTGG - Intronic
1096187518 12:49591415-49591437 AGGTGGGCAGCTTTTTCTTTCGG - Intronic
1097241385 12:57577897-57577919 AAGTGAGTCACTTATCCTTTAGG - Intronic
1101554853 12:105799474-105799496 ATGTGGAACACTTTTCTCTTTGG + Intergenic
1106537549 13:30660557-30660579 ATGTGTGACAGTTTTCCTTATGG + Intronic
1107376798 13:39812341-39812363 ACGTGTGAAACTTATCCTTTTGG + Intergenic
1109610876 13:64763145-64763167 GGGTGGGACACTTTTGCTACAGG - Intergenic
1113014524 13:105813267-105813289 ATTTAGGACATTTTTCCTTTTGG + Intergenic
1113898565 13:113782849-113782871 AGGTGGGGGACTTTTCTTTCGGG + Intronic
1114485472 14:23058997-23059019 AGGATGGCCACTTTTCCATTTGG + Exonic
1115258153 14:31424568-31424590 CAGTGGGACACATTTCCATTTGG - Intronic
1117369556 14:55063906-55063928 AAGTGGGGTACTTTTCCATTTGG - Intronic
1117820711 14:59645698-59645720 AGTATGGACACTTTTCCATTAGG - Intronic
1118697319 14:68397694-68397716 AGCTGCTACACTTCTCCTTTTGG - Intronic
1119127811 14:72144332-72144354 AGTTTGCAAACTTTTCCTTTAGG - Intronic
1119887912 14:78159472-78159494 AGGTGGGAGACGTTTACTATAGG - Intergenic
1121185442 14:91963595-91963617 GGGTGGGAAACTTGTCCTTTGGG + Intergenic
1121310908 14:92934505-92934527 AGGTGGGAGTCTGTTCTTTTAGG - Intronic
1127730896 15:61801063-61801085 AGGTGGGACCCTTGTCCATGGGG - Intergenic
1128048415 15:64640535-64640557 ATGCGAGGCACTTTTCCTTTTGG - Intronic
1128947247 15:71835207-71835229 AGGTTGAAAGCTTTTCCTTTGGG + Intronic
1130216259 15:81973257-81973279 ATATGGTAAACTTTTCCTTTAGG - Intergenic
1130807174 15:87335836-87335858 AGGGGAGACACATTACCTTTAGG + Intergenic
1132059108 15:98676813-98676835 AGGTTGTATACTTTTCCTTTTGG + Intronic
1134223578 16:12374551-12374573 AGGTGTTCCCCTTTTCCTTTTGG + Intronic
1136246090 16:28976990-28977012 AAGTGGGACAGTTTTCCCATAGG + Intronic
1138886665 16:61088249-61088271 AGCTGGTTCAGTTTTCCTTTAGG + Intergenic
1141004330 16:80338005-80338027 AGGTTGGCCACTTTTCCTGGAGG - Intergenic
1144335279 17:14263291-14263313 AAGTGGGACCCTCTTCCTCTGGG + Intergenic
1145725510 17:27118271-27118293 AGGTTGGACAAGTTTGCTTTAGG - Intergenic
1147039859 17:37710215-37710237 CGGTGGGACACTGTTTGTTTTGG - Intronic
1147380877 17:40055427-40055449 AGGTGGGTAACATTTGCTTTCGG - Intronic
1148399264 17:47339991-47340013 AGGTGGGAGACTCTTCCAGTAGG - Intronic
1150570273 17:66379748-66379770 AGGTCGGTCACTTATGCTTTTGG + Intronic
1150770524 17:68036933-68036955 AAGGGGGACACTTCCCCTTTGGG + Intronic
1153904403 18:9648284-9648306 AGGTGGGAAACTTTTCTTACAGG - Intergenic
1156862775 18:41857464-41857486 ACGGGTGACACTTTTCCTTCAGG + Intergenic
1158067065 18:53423359-53423381 AGATGGGTCACTGTTGCTTTGGG + Intronic
1160657919 19:282776-282798 ACTCGGGACACTCTTCCTTTGGG - Exonic
1160668236 19:343667-343689 GGGTGGGCACCTTTTCCTTTGGG + Intronic
1163909318 19:20175702-20175724 ACATGGGAGACTTTTCATTTTGG - Intronic
1164291621 19:23874443-23874465 TGGTGGGATAGTTTTCATTTGGG + Intergenic
1166761316 19:45226000-45226022 AGCTTGGAGACTTTTCCGTTAGG + Intronic
925454619 2:4004597-4004619 AGGTCTGACACTTGTTCTTTTGG + Intergenic
928642549 2:33315557-33315579 AGTTGCCACAGTTTTCCTTTAGG - Intronic
928980179 2:37129253-37129275 AGGTGGGGGAGTTTCCCTTTGGG - Intronic
930029018 2:47047126-47047148 AGGAGGCCCACTTTCCCTTTGGG - Intronic
930146437 2:48011134-48011156 AAGTGGAACTCTTTTACTTTTGG + Intergenic
931231010 2:60374955-60374977 AGGTCTGACTCTTTTCATTTGGG - Intergenic
931532951 2:63237486-63237508 TGGTAGCACAATTTTCCTTTGGG - Intronic
931981125 2:67695105-67695127 AAGTGGGCCAGCTTTCCTTTCGG - Intergenic
935603288 2:104944477-104944499 AGGTGGCACACTTTTCTTCAAGG + Intergenic
936039437 2:109138640-109138662 AAGTGGGTCACTCTTCCTCTGGG + Intronic
936554126 2:113478188-113478210 TGGTGGGACAATTTTGCTTAAGG + Intronic
937389517 2:121471933-121471955 CAGTGGGTGACTTTTCCTTTGGG - Intronic
938630173 2:133158103-133158125 AAATCGGACACTTGTCCTTTAGG + Intronic
939521157 2:143232313-143232335 AAGGGGGACAGTTTTCTTTTTGG - Intronic
939996834 2:148927646-148927668 GGGTGGGACCTTTTTCCTTTGGG + Intronic
942847407 2:180443166-180443188 TGGTGGGCCACTTTTCCTTAGGG + Intergenic
943826602 2:192402293-192402315 GAGAGGGTCACTTTTCCTTTAGG + Intergenic
946605568 2:221400454-221400476 AGGTTGGATAGTTCTCCTTTTGG + Intergenic
1170179567 20:13514455-13514477 AATTGGGACACCTTTCCTTATGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172926356 20:38540088-38540110 CAGTGGAACACTTGTCCTTTTGG + Intronic
1176064347 20:63187035-63187057 AGGTGGGACAATTTGCCTTCCGG + Intergenic
1181539930 22:23567579-23567601 GGGTGGGACAGTCTTCCTCTGGG + Intergenic
1183842809 22:40514449-40514471 AGGAGGGACATTTTTGTTTTTGG - Intronic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
955457299 3:59137850-59137872 AGGATGGACAGCTTTCCTTTTGG + Intergenic
956992022 3:74777838-74777860 AGCTGGGACACTGTCACTTTAGG + Intergenic
960033398 3:113078140-113078162 AGATGGGACACTTCCCCTTATGG - Intergenic
962089411 3:132227545-132227567 TGGTGGGACACTTTGGATTTTGG - Intronic
963690846 3:148500632-148500654 AGCTGGGACATTTTTGTTTTAGG + Intergenic
963880527 3:150523544-150523566 AGGTGGTCCACTTTCCCTTTGGG + Intergenic
965789032 3:172367920-172367942 GCCCGGGACACTTTTCCTTTTGG + Intronic
967991823 3:195137191-195137213 GGGTGTGACACTTTTCTTCTGGG + Intronic
968683644 4:1940497-1940519 AGGTGTGACACTTTTTTGTTCGG + Intronic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
970627953 4:17910953-17910975 AAGAGGGACACTATTCGTTTTGG + Intronic
972860205 4:43159133-43159155 GGGTGGGTCTTTTTTCCTTTGGG + Intergenic
974353402 4:60779717-60779739 AGATGGGACAGTTATCTTTTGGG - Intergenic
977707996 4:100092910-100092932 TGGTGAGAAACTTTTCCTTTCGG - Intergenic
978352623 4:107836252-107836274 ATGTGGGATATTTTTCCTTAAGG - Intronic
978621122 4:110635128-110635150 AGATGGGAGACTTTTCCTGATGG + Intronic
980411538 4:132425854-132425876 AGGGGGGACATGTATCCTTTTGG + Intergenic
982082114 4:151800494-151800516 AGGTCTGACCCTTTTCCTTGTGG - Intergenic
982766372 4:159353680-159353702 AGCTGGGAGACTCTTCCATTCGG + Exonic
983445990 4:167852971-167852993 AGGTGGAACATTTGTCCTTGGGG - Intergenic
984521047 4:180801361-180801383 AGGAAGGACACTTTTCATGTGGG - Intergenic
986711591 5:10491866-10491888 TGATAGCACACTTTTCCTTTGGG + Intergenic
987910912 5:24144173-24144195 TTGTGGGTCATTTTTCCTTTTGG - Intronic
988877444 5:35462866-35462888 AAGTGGGAATCTTTTCCCTTTGG - Intergenic
988879325 5:35483669-35483691 AGTTGTGACAATTTTCTTTTGGG - Intergenic
989391548 5:40905837-40905859 AGAGGGGACATTTTTACTTTGGG - Intergenic
989554517 5:42777637-42777659 AAGTGTAACACTTTTCCTATCGG + Intronic
990956105 5:61341166-61341188 AGATGGGACAATTTGCCTTAAGG - Intronic
993668383 5:90729675-90729697 AGATGGGACAGTCTTCCTTCAGG + Exonic
998036345 5:138920281-138920303 AGGTGTCACACTTTTTATTTCGG + Intronic
999074488 5:148781376-148781398 AGGTTGGCCACTTTTCCATAAGG - Intergenic
999315738 5:150582731-150582753 AGGTGGGATACTTTCCTTTTTGG - Intergenic
1000295452 5:159909405-159909427 TGGTGGGAACCTTTTCCTTGGGG - Intergenic
1001540477 5:172534284-172534306 AGTGGGGACACTTTTCCTAGTGG + Intergenic
1004720666 6:18265083-18265105 AGGTAGGATCTTTTTCCTTTCGG - Intergenic
1007985998 6:46207181-46207203 ATGTGGGTCACTTTTTTTTTTGG - Intergenic
1008760878 6:54849665-54849687 CGGTAGGAAACTTTTCCTCTGGG + Intronic
1012288023 6:97417139-97417161 AGGTCGGTGTCTTTTCCTTTAGG + Intergenic
1012810753 6:103954697-103954719 ATGTGGAATACTTTTACTTTAGG - Intergenic
1012837363 6:104286538-104286560 GGGTGGGACTCTTGCCCTTTGGG - Intergenic
1014805439 6:125824331-125824353 ACTTGGGAGACTTTTGCTTTTGG + Intronic
1014943144 6:127466566-127466588 AGCAGGTACACATTTCCTTTCGG + Intronic
1017119155 6:151007424-151007446 AAGTGGGAGAATTATCCTTTTGG + Intronic
1018074641 6:160200913-160200935 AGTTGGTACACATTTCCTTGGGG - Intronic
1021327121 7:19286929-19286951 AGATGGGAAATTTTTCTTTTGGG - Intergenic
1024633675 7:51269262-51269284 AAGTGGCTCATTTTTCCTTTAGG + Intronic
1032359491 7:131242194-131242216 AGTTGAAACACTTTTACTTTTGG + Intronic
1032463169 7:132126606-132126628 AGGTCAGAGACTTTTCCTGTGGG + Exonic
1033428346 7:141265653-141265675 AGGTGGGGCACGTCTCTTTTGGG + Intronic
1034055108 7:148026057-148026079 AGGTTGGACCCTTGTCCCTTAGG + Intronic
1037115669 8:15223371-15223393 AGGTGGGAGAATGTTCCTTTTGG - Intronic
1039234454 8:35486741-35486763 ATGTGTGACACTTTTCATATGGG - Intronic
1040443936 8:47474148-47474170 AGGTTTGATATTTTTCCTTTTGG - Intronic
1042506374 8:69565268-69565290 ATGTGTGACACCTTTCATTTTGG - Intronic
1042781030 8:72491297-72491319 AGGTGGGAGACATTTCCATCAGG + Intergenic
1043608287 8:82029545-82029567 AGGTGTGATAATTTGCCTTTAGG - Intergenic
1043812251 8:84754918-84754940 AGGTGGTACAAATTTCTTTTTGG + Intronic
1045339193 8:101236619-101236641 AGGTGGGACATTGGTTCTTTTGG + Intergenic
1046583219 8:116119350-116119372 ACGTGGGACATTTTTCATGTTGG + Intergenic
1048230750 8:132638522-132638544 AGGTGGGACATATTTCATCTTGG + Intronic
1049448305 8:142641861-142641883 AGGTGGGGCTGTGTTCCTTTCGG + Intergenic
1049898875 9:138983-139005 TGGTGGGACAATTTTGCTTAAGG - Intronic
1050061145 9:1711103-1711125 AGATGGGACACATTTCATGTGGG - Intergenic
1051907377 9:22111584-22111606 ATATGTGACATTTTTCCTTTAGG + Intergenic
1052755275 9:32534614-32534636 AGTTGGGAAACTTTTCCTCTAGG - Intergenic
1053741930 9:41149294-41149316 TGGTGGGACAATTTTGCTTAAGG - Intronic
1054347191 9:63979097-63979119 TGGTGGGACAATTTTGCTTAAGG - Intergenic
1054444925 9:65305439-65305461 TGGTGGGACAATTTTGCTTAAGG - Intergenic
1054485348 9:65716067-65716089 TGGTGGGACAATTTTGCTTAAGG + Intronic
1054686413 9:68282006-68282028 TGGTGGGACAATTTTGCTTAAGG + Intronic
1054812032 9:69442483-69442505 AGGTGGGTAACTTTTCCTGCAGG + Intronic
1056403334 9:86249527-86249549 AGGTGGGAGACGTTTTCCTTTGG - Intronic
1057555064 9:96081542-96081564 AGGCGGTCCACTTTCCCTTTGGG - Intergenic
1061751715 9:132782775-132782797 AGGGTGGACACTTAGCCTTTGGG + Intronic
1190143343 X:47867395-47867417 AGGAAGGTCTCTTTTCCTTTTGG + Intronic
1193068221 X:77279926-77279948 ACATGGGAGACTTTTCATTTTGG + Intergenic
1193379818 X:80805962-80805984 AGATGGGATACTTTTTCTTGGGG - Intronic
1202160277 Y:21926808-21926830 AGCTGGTTCACTTTTCATTTAGG + Intergenic
1202231079 Y:22659570-22659592 AGCTGGTTCACTTTTCATTTAGG - Intergenic
1202312079 Y:23536595-23536617 AGCTGGTTCACTTTTCATTTAGG + Intergenic
1202558724 Y:26133999-26134021 AGCTGGTTCACTTTTCATTTAGG - Intergenic