ID: 1184405324

View in Genome Browser
Species Human (GRCh38)
Location 22:44297568-44297590
Sequence CAGAGCTACCACCGTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184405324_1184405337 17 Left 1184405324 22:44297568-44297590 CCCACCTCACGGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1184405337 22:44297608-44297630 CCCACCACTCTGCTCAGGGGCGG 0: 1
1: 0
2: 1
3: 22
4: 213
1184405324_1184405335 14 Left 1184405324 22:44297568-44297590 CCCACCTCACGGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1184405335 22:44297605-44297627 CCTCCCACCACTCTGCTCAGGGG 0: 1
1: 0
2: 3
3: 33
4: 324
1184405324_1184405331 12 Left 1184405324 22:44297568-44297590 CCCACCTCACGGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1184405331 22:44297603-44297625 ACCCTCCCACCACTCTGCTCAGG 0: 1
1: 1
2: 0
3: 20
4: 259
1184405324_1184405333 13 Left 1184405324 22:44297568-44297590 CCCACCTCACGGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1184405333 22:44297604-44297626 CCCTCCCACCACTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 22
4: 326
1184405324_1184405339 20 Left 1184405324 22:44297568-44297590 CCCACCTCACGGTGGTAGCTCTG 0: 1
1: 0
2: 0
3: 4
4: 113
Right 1184405339 22:44297611-44297633 ACCACTCTGCTCAGGGGCGGAGG 0: 1
1: 0
2: 0
3: 10
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184405324 Original CRISPR CAGAGCTACCACCGTGAGGT GGG (reversed) Intronic
901879929 1:12187846-12187868 CAGAGCCACCCCCGTGGTGTTGG - Intronic
902133186 1:14281503-14281525 CAGAGCTAGAACAGTGAGCTTGG - Intergenic
902624316 1:17667753-17667775 CAGAGCTGCCCCTGTGAGCTGGG + Intronic
905186039 1:36197471-36197493 CAGAGCTTCCACAGTGTGGAAGG - Intergenic
910867780 1:91803812-91803834 CAGATCTAACACAGTGAGGGAGG - Intronic
912380751 1:109247038-109247060 CAGAGCCTCCACTGTGAAGTGGG + Intergenic
912755024 1:112317093-112317115 CAGAGCTTCCACCCTAAGGAGGG - Intergenic
913237443 1:116797047-116797069 CAGAACATCCACCGTGAGGCAGG + Intergenic
915906177 1:159878972-159878994 AATAGATACCACCGTGAGGTCGG + Intronic
920363944 1:205438325-205438347 CAGAGACTCCACCTTGAGGTGGG - Intronic
920851069 1:209628025-209628047 CAGGGCTGCCACCGTGAGTAGGG - Exonic
1064449064 10:15425575-15425597 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1067935210 10:50605328-50605350 CAGAGCTGCCACAGTGAGACAGG + Intronic
1071337929 10:84616904-84616926 CAGAGCCACCACAGAGAGCTAGG + Intergenic
1071493903 10:86154779-86154801 CAGAGCTGCCATCGTAAGCTGGG + Intronic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1075314037 10:121437892-121437914 CAGAGTTTGCACCGTGAAGTGGG + Intergenic
1076472325 10:130727795-130727817 CTGAGCTACTGCCATGAGGTGGG - Intergenic
1077225791 11:1438620-1438642 CAGAGCCACCAGCCTGAGGCTGG + Intronic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079867737 11:25757001-25757023 CAAAGCTTCCACAGTGAGGAAGG - Intergenic
1082641415 11:55665885-55665907 CAATACAACCACCGTGAGGTGGG - Exonic
1083967729 11:66052702-66052724 CAGAGCTACACCCGCCAGGTAGG + Exonic
1084768334 11:71326619-71326641 CAGATCTTCCTCCGTGGGGTTGG - Intergenic
1092684866 12:11031527-11031549 CAAAGCTTCCACCGGGAGGAAGG + Intronic
1096392556 12:51240283-51240305 CAGAGCTACCAAAATGAGGCAGG - Intronic
1097101124 12:56590285-56590307 CAGATCTTCCACCGTGTGGAAGG - Exonic
1104944571 12:132409869-132409891 CAGAGCTGCCACCGTCCTGTGGG + Intergenic
1110256412 13:73438609-73438631 CAGAGCTACCACAGTTATGAAGG + Intergenic
1110862274 13:80356373-80356395 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112488352 13:99840064-99840086 CAGAGTTCCCAGCGTGGGGTGGG - Intronic
1117565770 14:56991866-56991888 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1124221233 15:27851435-27851457 CTGAGCCACGACCCTGAGGTTGG - Exonic
1124416497 15:29476743-29476765 CAGAGGTACCAAAGTGAGGGCGG + Intronic
1124786938 15:32690239-32690261 GAGAGCTACTACCATGGGGTGGG - Intronic
1134468849 16:14503692-14503714 GATAGCTACCACCCTGAGGCAGG - Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1137671612 16:50282577-50282599 CAGAGCTATGACCAAGAGGTGGG - Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1139147882 16:64344819-64344841 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1141758870 16:86013606-86013628 CATAGCTGCCTCCGTGAGCTGGG - Intergenic
1142450967 16:90173015-90173037 CATAGCTACCACAGGCAGGTGGG - Intergenic
1142923968 17:3216345-3216367 CAAAGAGACAACCGTGAGGTGGG - Exonic
1146197304 17:30824560-30824582 CAGAGCTACCGGCGGGAGCTGGG - Exonic
1147133431 17:38421815-38421837 CAGAGCTTCGACGGGGAGGTGGG + Intergenic
1147498300 17:40938235-40938257 CCCAGCTTCCACCATGAGGTGGG - Intergenic
1150493300 17:65589071-65589093 CAGGGTTCCCACAGTGAGGTGGG - Intronic
1151513733 17:74578904-74578926 CAGAGCTAGAACTGTGAGCTGGG - Intergenic
1152840763 17:82566674-82566696 CACAGCTGCCACCCTGAGGTTGG + Intronic
1158282186 18:55840275-55840297 CAAAGCTTCCACCCTGTGGTAGG + Intergenic
1159519182 18:69496103-69496125 CAGATCTACCGCCGTGACTTGGG + Intronic
1161675545 19:5646298-5646320 CAGAGCTCCAACCTTGAGGAGGG + Intronic
1164421162 19:28094145-28094167 CAGATCTACCATGGTGTGGTGGG - Intergenic
1165798410 19:38532668-38532690 CAGAGCTGCCACCTGGAGGAGGG + Exonic
1167420636 19:49400929-49400951 CTTAGATACCACCTTGAGGTCGG - Intronic
1168401467 19:56088096-56088118 CAGAGCTACTACCGCGCGGGCGG - Exonic
926146049 2:10397672-10397694 CTGAGCTAACTCCGTGAGCTCGG + Intronic
926686023 2:15698279-15698301 CAGAGCTAGCACAGTGATGCTGG - Intronic
931574866 2:63708706-63708728 TAGAGCTCCCAGCGTGAGCTGGG - Intronic
941851816 2:170190927-170190949 CATTGCTACCACAGTTAGGTAGG + Intronic
944890983 2:204117215-204117237 CAGTGCTAGCATGGTGAGGTTGG + Intergenic
946366386 2:219251757-219251779 CACAGCTACCACCCTGGGGGAGG - Intronic
1168981171 20:2005052-2005074 AAGAGCAAACACCCTGAGGTGGG - Intergenic
1176020602 20:62960702-62960724 CAGGGCCACCATGGTGAGGTGGG + Intronic
1181101838 22:20545968-20545990 CAGAGATACAACCCTGAGGGTGG - Intronic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1183484794 22:38082974-38082996 CAGGGCTACCCACGTGAGGGTGG + Intronic
1184405324 22:44297568-44297590 CAGAGCTACCACCGTGAGGTGGG - Intronic
1185382571 22:50516897-50516919 CAGAGGCCCCACCGTGAGGGTGG - Intronic
949841862 3:8328592-8328614 CAGACCTAGGACCCTGAGGTCGG - Intergenic
950470988 3:13186260-13186282 CAGAGCTTCCACCCAGAGGCAGG - Intergenic
950702730 3:14761341-14761363 CAGAGCTTACGCCGTGAGGCAGG - Intronic
953930571 3:47003779-47003801 CAGAGCCTACAGCGTGAGGTGGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957870279 3:86082957-86082979 CAGAGCTTGCACCGTGAGCCTGG - Intergenic
958601051 3:96297864-96297886 CAGAGCTTCCACAGTGTGGAAGG - Intergenic
958807867 3:98833820-98833842 CAGAGCTCCCACTGGGAGGGTGG - Intronic
959911674 3:111770714-111770736 CAGTTCTACCTCTGTGAGGTGGG - Intronic
964451989 3:156822028-156822050 CAGAGCTTCCACAGTGTGGAAGG + Intergenic
965358698 3:167710154-167710176 CATAGCCACCACAGTGAGCTGGG - Intronic
969870782 4:10103378-10103400 CAGAAATGCCACCATGAGGTTGG - Intronic
974804533 4:66861018-66861040 CAAAGCTTCCACCGTGTGGAAGG - Intergenic
976690455 4:87863037-87863059 CAAAGCTTCCACCGTGTGGAAGG + Intergenic
977821634 4:101478557-101478579 CAAAGCTTCCACCGTGTGGAAGG - Intronic
988201624 5:28077011-28077033 CAAAGCTACCACAGTGTGGAAGG + Intergenic
989559810 5:42837204-42837226 CAAAGCTACCACAGTGTGGAAGG - Intronic
996358998 5:122624962-122624984 CATTGCTACCACTGTGAGGAAGG - Intergenic
996810662 5:127513315-127513337 AAGAGCTAACACTGTGAGTTAGG + Intergenic
996815718 5:127570427-127570449 CAAAGCTACCACAGTGTGGAAGG - Intergenic
1002126549 5:177049777-177049799 CAGAACTACCCCAATGAGGTAGG - Intronic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1005767442 6:29026873-29026895 CAGAATTACTACTGTGAGGTGGG + Intergenic
1008419482 6:51280569-51280591 CAAAGCTTCCACAGTGTGGTAGG - Intergenic
1009685514 6:66950344-66950366 CAAAGCTACCACAGTGTGGCAGG - Intergenic
1011836104 6:91433223-91433245 CGCAGCTACCAACATGAGGTAGG + Intergenic
1012760351 6:103293908-103293930 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1014310009 6:119787875-119787897 CTAAGCTACCACGGTGAGGAAGG - Intergenic
1017129922 6:151099410-151099432 CAGAGCCACTACAGTGAGGCTGG + Intronic
1017452317 6:154565517-154565539 CTGAGCTACCATCATGAGCTGGG + Intergenic
1018945527 6:168345276-168345298 CAGAGCACCCTCCGTGAGGCCGG + Intergenic
1022469600 7:30674236-30674258 CAGAGCTTACACAGTGAGCTGGG - Intronic
1029333066 7:99876287-99876309 AAGAGAAACCACCGTGAGGTGGG + Exonic
1031903010 7:127430119-127430141 CAAAGCTTCCACAGTGAGGAAGG - Intronic
1036296300 8:7540926-7540948 CAGAGAGACCACAGTGAGGGAGG - Intronic
1036326266 8:7780093-7780115 CAGAGAGACCACAGTGAGGGAGG + Intronic
1037239361 8:16759946-16759968 CAGAGCTCCCACGGTGGGGAAGG + Intergenic
1043374234 8:79630139-79630161 TAGAGCTATCACCGTGGGATGGG - Intronic
1043889596 8:85642113-85642135 TAGAGCCACCACAGTGAGATGGG - Intergenic
1056840996 9:89997810-89997832 CAGAGCCACCTCCCTGTGGTGGG + Intergenic
1058391914 9:104504990-104505012 CAAAACTACCACCATCAGGTGGG - Exonic
1059953965 9:119496706-119496728 CTGACCTACCACCATGAGGCTGG - Intronic
1060009068 9:120027419-120027441 CAGAGCTACCTCCTTGATGGGGG - Intergenic
1061574698 9:131498761-131498783 CAGAGCTGCCAGCGTCAGGAGGG - Exonic
1186281947 X:8002710-8002732 CAAAGCTTCCACAGTGCGGTAGG + Intergenic
1199134039 X:144230763-144230785 CAAAGCTACCACAGTGTGGAAGG + Intergenic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1200400169 X:156015335-156015357 CAGAGATGCCCTCGTGAGGTCGG - Intergenic