ID: 1184405586

View in Genome Browser
Species Human (GRCh38)
Location 22:44298771-44298793
Sequence CGGGGAGGGCAGGCCCGGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 731
Summary {0: 1, 1: 1, 2: 11, 3: 65, 4: 653}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184405571_1184405586 20 Left 1184405571 22:44298728-44298750 CCTCAAGGGACTGGGAGGAGCCT 0: 1
1: 0
2: 2
3: 31
4: 235
Right 1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG 0: 1
1: 1
2: 11
3: 65
4: 653
1184405577_1184405586 0 Left 1184405577 22:44298748-44298770 CCTGATATGCAGAGATGGGGGGC 0: 1
1: 0
2: 2
3: 15
4: 113
Right 1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG 0: 1
1: 1
2: 11
3: 65
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184405586 Original CRISPR CGGGGAGGGCAGGCCCGGCG AGG Intronic
900100251 1:959420-959442 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
900142674 1:1145162-1145184 CGGGGAGCACAGGCCAGGAGGGG - Intergenic
900227475 1:1539991-1540013 GGGGGAGCGCAGGCCCGGGAGGG + Intronic
900313271 1:2044887-2044909 CGGGCAGGGCCGGCGCTGCGCGG + Intergenic
900314523 1:2050354-2050376 CGGGGCGGGCGGTCCCGGGGCGG - Intergenic
900349266 1:2227262-2227284 CGGGCGGGGCGGGGCCGGCGCGG + Intergenic
900349481 1:2227947-2227969 CGCGGGGGGCGGGGCCGGCGCGG + Intergenic
900484058 1:2913180-2913202 CCAGGAGGGCAGGGCCAGCGTGG - Intergenic
900582438 1:3415735-3415757 CGGGGGTGGCAGGCCCGTGGGGG - Intronic
900592973 1:3468026-3468048 CGGCCAGGGCAGGCCCAGCGTGG + Intronic
900604944 1:3519758-3519780 CTTGGAGGGGAGGCCCGGCCCGG - Intronic
900633874 1:3652459-3652481 CGGGGAGGGGAGGCGCCGCGGGG - Intronic
900654241 1:3747185-3747207 CGGGCAGGGCCGGCCCGCCTGGG + Intergenic
900919477 1:5661572-5661594 CGTGAAGGGCTGGCCAGGCGTGG - Intergenic
901016724 1:6236098-6236120 CGGGGAGGGGCGGGCGGGCGGGG - Intergenic
901422816 1:9162405-9162427 CGTGGAGGTCAGGCCAGGTGGGG + Intergenic
901633711 1:10659964-10659986 CGGGGAGGGCAGCCCCGACATGG - Exonic
901886966 1:12230160-12230182 CGGGAACTGCAGGGCCGGCGCGG + Intronic
902191906 1:14769642-14769664 CTGGAAGGGCAGGCCGGGCACGG - Intronic
902686213 1:18079315-18079337 AGGGGAGGGCAGGGCAGGAGGGG + Intergenic
902916690 1:19644110-19644132 CGGGGCGGGCGGGCCAGGAGAGG + Intronic
903750416 1:25617489-25617511 CGGGGAGGGCTCGGCCGGAGGGG + Exonic
903833393 1:26188277-26188299 CGGGGTGGGGGGGCCCGGCCTGG - Exonic
903847253 1:26285720-26285742 CGTGGAGGGCAGGCTGGGCCTGG + Intronic
904237390 1:29123983-29124005 CGGTGGGGCCGGGCCCGGCGCGG - Intergenic
904625832 1:31801546-31801568 GGGGGAGGGCAGGCTGGGTGGGG + Intronic
904724988 1:32539968-32539990 CGGGGAGGGCAGGGCAGGGCCGG + Intronic
904751056 1:32741747-32741769 CGGGGAGGGAAGGAGCGGGGCGG - Intergenic
905375309 1:37516207-37516229 AGGGGAATGCAGGCCGGGCGCGG + Intergenic
905647291 1:39633317-39633339 CGCAGAGGGAAGGCCCGGAGTGG - Intronic
905775615 1:40665552-40665574 CGGGGCGGGGAGGGGCGGCGAGG + Exonic
906170819 1:43723397-43723419 AGAGGAGGGAAGGCCGGGCGTGG - Intronic
907243812 1:53094717-53094739 CGGGGAGGGCGGAGCCGGCAGGG - Intronic
907305236 1:53509475-53509497 CAGGGAGGGGAGGGCAGGCGAGG + Intronic
907305239 1:53509480-53509502 AGGGGAGGGCAGGCGAGGGGTGG + Intronic
907306878 1:53518152-53518174 CGGGGAGGGCAGGACCAGGCAGG - Intronic
907477559 1:54715728-54715750 CGAGGAGGGCGGGCCGGGGGAGG + Intronic
912546015 1:110452472-110452494 CGGTGAGGGCAGGAGCAGCGTGG + Intronic
912798599 1:112707167-112707189 CGGGGAGGGCGGGCCCGGCAGGG + Intronic
913144506 1:115976470-115976492 CGGGGCGGGCCGGGCCGGGGCGG - Intergenic
913222049 1:116667602-116667624 GGGCGAGGTCAGGCTCGGCGGGG - Exonic
914357193 1:146897026-146897048 CAGGGAGTGAAGGCCAGGCGCGG + Intergenic
914824756 1:151132762-151132784 CGGAGAGCGCGGGCCGGGCGGGG + Exonic
914873215 1:151492706-151492728 TGGGGACTGCAGGCCGGGCGCGG + Intergenic
915318396 1:155042685-155042707 CCTGGAGGACAGGCCCGGGGAGG + Intronic
915484794 1:156212837-156212859 CGGGGAGGCGAGGCTCTGCGCGG - Intergenic
915489803 1:156244740-156244762 CGGTGAGGGCACGCCTGGCCCGG - Exonic
915552257 1:156642050-156642072 CGGGGAGGGCGGGGCAGGGGCGG + Exonic
917869652 1:179229794-179229816 CGGGGACGGGGGGCGCGGCGCGG - Intergenic
919820524 1:201469220-201469242 CGCGGAGGGGAGGGCCGGCCAGG - Intronic
920184656 1:204152238-204152260 CCGGGAAGCCAGCCCCGGCGGGG - Intergenic
920295720 1:204954907-204954929 CGGGGATGGAAGTCCAGGCGGGG - Exonic
920385764 1:205569348-205569370 AGGGAAGGGTCGGCCCGGCGAGG - Intronic
921266338 1:213423777-213423799 TGGGGAAGGCAGGCCCAGAGGGG + Intergenic
922503038 1:226110573-226110595 TGGGGAAGGCAGGGCCGGCGCGG + Intergenic
922702189 1:227768319-227768341 CGGGGAGCCCATGCCCTGCGTGG - Intronic
922718222 1:227887664-227887686 AGGGGAGGGCAGCCGTGGCGTGG + Intergenic
922894618 1:229090421-229090443 TGGGGAGGAGAGGCCAGGCGTGG - Intergenic
923147606 1:231209131-231209153 CGGGGTGGCCAGGGCCAGCGTGG + Exonic
923738320 1:236633041-236633063 AGGGGAGGGGAGGCCAGGGGAGG - Intergenic
924527073 1:244863057-244863079 CGGGGAGCGCGGGCCCGCGGGGG - Intronic
1062774781 10:135739-135761 CGGGGCGGGCCGGGCCGGCGGGG + Intronic
1062874054 10:931390-931412 CCGGGAGGGACGGCCCGCCGCGG + Intronic
1062874213 10:931972-931994 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
1062901941 10:1153083-1153105 CGGTGAGTGCAGGCCGGGCAGGG - Intergenic
1063112001 10:3046024-3046046 GGGGGAGGGCAGCCCTGGAGCGG + Intergenic
1063377695 10:5563897-5563919 GTGGGTGTGCAGGCCCGGCGGGG - Intergenic
1063949864 10:11212337-11212359 CTGTGAAGGCAGGCCCGGGGGGG - Intronic
1064418120 10:15168296-15168318 CGGGGAGGCGAGGCCCGGGGTGG - Intronic
1065099893 10:22321859-22321881 CGGGGCCGGCAGGCGCGGGGCGG - Intronic
1065754528 10:28919118-28919140 GGGGGAGGGCTGGCCTGGTGAGG - Intergenic
1065872761 10:29970113-29970135 AGGGGAGGGAAGGCTGGGCGTGG + Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1066326787 10:34368380-34368402 AGGTGAGAGCAGGCCGGGCGCGG + Intronic
1067497756 10:46774869-46774891 GGGCGAGGGCAGGCCCAGCATGG + Intergenic
1067596893 10:47565545-47565567 GGGCGAGGGCAGGCCCAGCATGG - Intergenic
1067801437 10:49361891-49361913 CGGGCAGGGCAGGGCCAGAGTGG + Intergenic
1067802101 10:49366081-49366103 GGGGGAGGGCAGGCCGGGCGGGG + Exonic
1067937489 10:50624042-50624064 GGGGGCGGGCCGGCCGGGCGGGG + Intronic
1069615938 10:69806234-69806256 TGGGGAGGGCAAGCCTGGTGAGG + Intronic
1069744024 10:70703526-70703548 TGGGGAGGGCAGGGCTGGCGGGG + Intronic
1070069341 10:73071433-73071455 GGGGCAGGGCAGGGGCGGCGGGG + Intronic
1070768390 10:79069196-79069218 CGGGTAGGGCAGGCTCGGGCCGG - Exonic
1070800709 10:79243130-79243152 GGGGGAGGCCAGGCCAGCCGCGG - Intronic
1070912679 10:80132464-80132486 CCGGGAGGGAAGGCGGGGCGGGG - Intronic
1071500532 10:86200473-86200495 AGGGGAGGGCAGGCACAGCCTGG + Intronic
1073030179 10:100519646-100519668 CGGGCAGGGCAGGCGCGGGCCGG + Intronic
1073196401 10:101695054-101695076 CGGGAACGGCGGGCCCGGCGAGG - Exonic
1073464139 10:103684053-103684075 TGGGCAGGGCAGGCCCAGGGAGG + Intronic
1073467997 10:103705286-103705308 GGGGGAGGGAAGGGCGGGCGTGG + Intronic
1073974464 10:109085514-109085536 CGGGAATGGCAGGCCAGGCCCGG + Intergenic
1074819251 10:117166542-117166564 CGGGGGGCGCAGGCAGGGCGGGG + Intergenic
1074864203 10:117535500-117535522 CGGGCAGGGCAAGCGCTGCGTGG - Intergenic
1075483087 10:122798950-122798972 CTGGGAGGGCAGACACGGCCAGG - Intergenic
1075651458 10:124130313-124130335 AGGGGAGGGCAGGCCCAGAAGGG + Intergenic
1076005391 10:126944585-126944607 CGGGGAGCGGAGGCCCAGGGAGG + Intronic
1076175859 10:128367240-128367262 GGGGGAGGGCAGGGCCGGTGTGG + Intergenic
1076371600 10:129959289-129959311 CGGGGAGGGCAGGGCGAGGGAGG + Intronic
1076371661 10:129959536-129959558 CGCGCAGGGCAGGGCGGGCGCGG - Intronic
1076552191 10:131288509-131288531 GGTGGAGGGCAGGCCCTGGGTGG - Intronic
1076600646 10:131654896-131654918 CGGGCAGGGTTGGCCCCGCGAGG - Intergenic
1076638975 10:131901203-131901225 CGGGGCGGTCAGGCCGGCCGCGG - Intronic
1076683660 10:132187314-132187336 CGGGGCGCCCAGGCCCGGCCCGG + Intronic
1076738090 10:132467646-132467668 CTGGGAGGGCAGCCTCGGCCCGG - Intergenic
1076821807 10:132943318-132943340 CGGGGCGCGCAGCCCCCGCGCGG + Intergenic
1076992702 11:284073-284095 AGGGCAGGGCAGGCTCTGCGAGG + Intronic
1077051300 11:568253-568275 CGGGCTGGGCAGGCGCGGCGGGG - Intergenic
1077073723 11:690257-690279 AGGGGAGGGCAGGGCAGGGGAGG + Intronic
1077093530 11:789983-790005 CGGGGCGGGCGGGGCGGGCGCGG - Intronic
1077124438 11:926144-926166 CTGGGAGCGGAGGCCCGGGGCGG + Intronic
1077250087 11:1557082-1557104 GGGCGAGGACAGGCCCAGCGCGG + Exonic
1077317866 11:1927324-1927346 CAGGGAGGGCAGGCCCACCCAGG - Intronic
1077327861 11:1971454-1971476 GGTGGAGGGCAGGGCCGGAGAGG - Intronic
1077366606 11:2163760-2163782 CGGGGAAACCAGGCCCGGAGGGG + Intergenic
1077385847 11:2269187-2269209 CGGGCAGGGCCGGCCCGGGCGGG - Intronic
1077459325 11:2700750-2700772 TGGGCAGGGCGGGCCCGGCCGGG - Intronic
1077541303 11:3147745-3147767 GGGGCAGGGAAGGCCGGGCGTGG + Intronic
1079076598 11:17388741-17388763 CTGGGAAGGCAGGCTGGGCGGGG - Intronic
1079714654 11:23730603-23730625 CGGCCAGGGAAGGCCCTGCGGGG - Intergenic
1081694952 11:45103222-45103244 GGGAGGAGGCAGGCCCGGCGGGG - Intronic
1081857446 11:46312704-46312726 AGGGGAGGGCAGGTCAGGCAAGG - Intronic
1082067401 11:47911759-47911781 TTGGGAAGGCAGGCCAGGCGTGG + Intergenic
1082829352 11:57603857-57603879 TGGGGCGGGCGGGCCAGGCGCGG + Intronic
1083236636 11:61355156-61355178 AGGAGAGGCCAGGCCAGGCGTGG - Intronic
1083448507 11:62726991-62727013 CGGCGGGGCCGGGCCCGGCGGGG - Exonic
1083656985 11:64234571-64234593 CGGGGACGGCGGGGGCGGCGGGG - Exonic
1083674589 11:64318398-64318420 GGGGGATGTCAGGCCCGGCCGGG - Intronic
1083879162 11:65539792-65539814 AGGTGAGGGCAGGCCCGGCCAGG + Exonic
1083944997 11:65918868-65918890 GGGGCAGGGCAGGGCCGGGGCGG - Intronic
1084118750 11:67056825-67056847 TGCGCGGGGCAGGCCCGGCGGGG - Exonic
1084319535 11:68365722-68365744 CGGGGCGGGCGGGCGGGGCGGGG + Intronic
1084608185 11:70184593-70184615 CGGGTAGGGCAGGGCGGGCCAGG + Intronic
1084946608 11:72642180-72642202 GGGGGCGGGCAGACCCGGCCCGG + Intronic
1085485642 11:76860858-76860880 CGGGGAGGCAGGGCCGGGCGGGG + Exonic
1085520885 11:77138318-77138340 CGGGGTCGGCAGGGTCGGCGGGG - Intronic
1085574381 11:77589618-77589640 GGCGGAGGGCCGGCGCGGCGCGG - Exonic
1088598661 11:111457440-111457462 CTGGGAGGCCAGGCCAGGCATGG - Intronic
1089350798 11:117820616-117820638 CGGGGAGGGCAGGGCAGGCTTGG - Intronic
1089499039 11:118922161-118922183 AGGGGAGGTCAGGCCAGGCTGGG + Intronic
1090699163 11:129279196-129279218 CGCGGAGGGCAGACACGGAGCGG - Intronic
1090887855 11:130895093-130895115 CAGAGAGGGCAGGCTCGGTGGGG + Intronic
1202810841 11_KI270721v1_random:26634-26656 GGTGGAGGGCAGGGCCGGAGAGG - Intergenic
1092404572 12:8210005-8210027 TGGGGAAGGAAGGCCGGGCGCGG - Intergenic
1092659589 12:10723370-10723392 CCGGGAGGGAAGGGCGGGCGAGG + Intergenic
1095962217 12:47842760-47842782 GGGCCAGGACAGGCCCGGCGCGG - Exonic
1096191587 12:49623494-49623516 CCGGGAGGGCGGGGCCGGCGGGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1096615570 12:52831382-52831404 TGAGGAGAGCAGGCCAGGCGGGG - Intronic
1096652182 12:53067265-53067287 CAGGGAGGGCAGGCAGGGGGAGG + Intronic
1096782824 12:54000765-54000787 AGGGGAGGGGAGGACGGGCGGGG + Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1097891334 12:64780702-64780724 CCGGGAGGGCACCACCGGCGAGG + Intergenic
1097981508 12:65741628-65741650 AGGGGAGGGCAGGGGCGGGGCGG + Intergenic
1099014129 12:77324953-77324975 CGGGGCGGGGAGGCGCGGCCCGG + Intergenic
1099956047 12:89353488-89353510 CGGGGACTGCTGGCCCGGCCCGG - Intergenic
1099960823 12:89395356-89395378 TGGGGAGGGTAGGCCGGGCGCGG + Intergenic
1100260511 12:92928858-92928880 CGGGTGGGGCCGGCGCGGCGGGG - Intronic
1100315425 12:93441335-93441357 CGGGAGGGTCAGGCCGGGCGGGG - Intronic
1101151956 12:101891037-101891059 TGTGGGGGGCAGGCCGGGCGCGG - Intronic
1101592914 12:106139262-106139284 CGGGGAGGGGGCGCCCGGCTTGG - Exonic
1101606054 12:106248155-106248177 CGGAGAGGGAGGGCCGGGCGGGG + Intronic
1101606158 12:106248413-106248435 CGGGGATGGGCGGCCAGGCGGGG + Intronic
1101641105 12:106586300-106586322 TGGGGAGCGCAGGCCACGCGGGG - Intronic
1101740415 12:107495620-107495642 CATGGAGGGCAGGCCCTGAGAGG - Intronic
1102084374 12:110124242-110124264 CGGGGAGGACGGGCGCGGGGCGG - Intergenic
1103363919 12:120369053-120369075 CGGGGAGGCGAGGCCGGGCTGGG + Exonic
1103446346 12:120997465-120997487 CGTGGAGGCCAGGCCTGGAGTGG - Exonic
1103599637 12:122046271-122046293 TGGGGAGGGCAGGCCAGGTCTGG + Intronic
1103610557 12:122121661-122121683 CAGAGAGGGCAGGCCGGGCATGG - Intronic
1103742010 12:123097331-123097353 GGGAGATGGCAGGCCGGGCGCGG - Intronic
1104724686 12:131068423-131068445 CGGGGAGGGAAGGCGTGGAGTGG + Intronic
1104756401 12:131272352-131272374 CCGGGAGTGAAGGCCAGGCGAGG - Intergenic
1104783833 12:131437415-131437437 AGGGGAGGGCAGGCCCAGTGGGG + Intergenic
1104961514 12:132490405-132490427 CGGGCCGGGCATGCCGGGCGCGG - Exonic
1105014407 12:132777400-132777422 CGGGAAGGGGCGGCCCGGCGCGG - Intronic
1105256030 13:18744573-18744595 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1105977197 13:25482491-25482513 TGGGGAGGGCAGGCCAGACATGG + Intronic
1107467863 13:40666030-40666052 GGCCGAGGGCAGGCCCGCCGCGG + Exonic
1107839099 13:44437022-44437044 TGGGGTGGGCTGGCCTGGCGCGG + Intronic
1111396215 13:87672397-87672419 CTGGGAGGGGAGGCACGGAGCGG - Intergenic
1112331205 13:98478271-98478293 AGGGGAGGACAGGCTCGGGGAGG - Intronic
1112402470 13:99087672-99087694 CGGAGAGGGCGCGCCAGGCGGGG + Intergenic
1112570447 13:100588761-100588783 CGGGGAGGGCAGGGCCAGGGCGG + Intronic
1112752594 13:102597318-102597340 CGGGGTGGGCAGCACCGGGGTGG + Intronic
1113254786 13:108495501-108495523 CCCGGAGGGCTGCCCCGGCGGGG + Intergenic
1113379213 13:109787007-109787029 CGGGGAGGGGGCGCCGGGCGGGG + Intergenic
1113663973 13:112128162-112128184 CGAGGAGGGCAGGCCAGCCTGGG - Intergenic
1114628105 14:24142406-24142428 GAGGGAGTCCAGGCCCGGCGCGG + Intergenic
1114674238 14:24430206-24430228 CGCGGTGGGCGGGCCCGGCCCGG + Intronic
1115641820 14:35340127-35340149 CGGGGGGGGCAGGCTCTGAGAGG - Intergenic
1121454653 14:94030446-94030468 GGGAGAGGTCAGGCCCGGAGAGG + Intronic
1121473463 14:94174283-94174305 GGGGCGGGGCGGGCCCGGCGAGG - Intronic
1122145146 14:99684389-99684411 GGGGCAGGGCAGGCCAGGCCAGG - Exonic
1122444980 14:101761645-101761667 CGGGGCGGGCCGGCCGGGGGAGG + Intergenic
1122768210 14:104085645-104085667 CTGGGAGGGCGGGGCCGGCGGGG - Intergenic
1122814614 14:104306361-104306383 CGGGGAGGGCAGAGCAGGCAGGG + Intergenic
1122941999 14:104985669-104985691 CAGGGAGGGCGGGTCCGGGGCGG + Intergenic
1123032412 14:105458200-105458222 CGGGGAGGAGAGGCGCGGCCCGG + Intronic
1124250517 15:28104007-28104029 TGGGGAGGCCAGGCCCGTGGGGG + Intergenic
1124453654 15:29821864-29821886 CGGGGTGGGCAGGGCTGGCGCGG - Intronic
1127606587 15:60592735-60592757 GCGGGAGGGCAGGCCCGGCCGGG - Intronic
1127932678 15:63607366-63607388 CGGGGTGGGAAGGCCCTGCCTGG - Intergenic
1128092486 15:64928333-64928355 CGGGGAGGGCAGTGCCTGCCAGG + Intronic
1128700218 15:69798531-69798553 CTGGGATGGCAGGCCTGGCAGGG + Intergenic
1128738351 15:70066252-70066274 TGGGGAGGGCAGGGGAGGCGTGG + Intronic
1129105660 15:73305566-73305588 TGGGGAGGCCAGGCCCCACGTGG - Intergenic
1129455208 15:75673112-75673134 GGGGCAGGGCAGGCCGGGCCAGG + Intergenic
1129540259 15:76342573-76342595 CGGGCGGGGCGGGCCCGGTGGGG + Intergenic
1129595875 15:76963761-76963783 CTGGGAAGGCAGGTCAGGCGGGG + Intergenic
1130023591 15:80251760-80251782 CGGGGAGGGCCGGACCCGCGCGG - Intergenic
1130894359 15:88158782-88158804 GGTGGAGGCCAGGCCTGGCGTGG + Intronic
1131257586 15:90872104-90872126 CGGGGAGGGGAGGAGCGGCCGGG + Intronic
1132458072 16:35357-35379 CTGGGAGGGGAGGGCCGACGTGG - Intergenic
1132480674 16:164892-164914 CGGGGCGGGCCGGGCCGGGGCGG + Intronic
1132515563 16:364222-364244 CGGGGAGGGCGGGGTGGGCGTGG + Intergenic
1132544798 16:528105-528127 CGGGGAGCGCGGGCTCGGCGGGG + Intronic
1132640432 16:975830-975852 CGGGGAGGTCAGGGCCTGGGCGG + Intronic
1132658826 16:1052660-1052682 CAGGGAGGGCAGGGCAGGGGAGG + Intergenic
1132724590 16:1333379-1333401 CGGGGAGGGCGCGCGCGGCCAGG + Intergenic
1132746487 16:1438416-1438438 CAGGGAGGGCAGGCTGGGTGAGG + Intronic
1132746648 16:1438990-1439012 GGGGCAGGGCAGGCCAGCCGCGG + Intronic
1132805964 16:1775263-1775285 CGGGCAGGGCAGGCCCCATGGGG + Intronic
1132830049 16:1923580-1923602 CGGGGTGGGCAGCCCCAGCCTGG + Intergenic
1132884951 16:2178506-2178528 CGGGGAGGGCCCGGGCGGCGCGG + Exonic
1133119230 16:3596095-3596117 CGGGGAGGGGAGGCCCGGGAGGG + Intronic
1133662042 16:7927690-7927712 TAGGGAGGACAGGACCGGCGAGG - Intergenic
1133771294 16:8868545-8868567 TGGCGCGGCCAGGCCCGGCGGGG + Intronic
1134110532 16:11512851-11512873 CGGGGAGGGCAGACCAAGCTGGG + Intronic
1134799540 16:17071616-17071638 CGGGGAGGGGAGGAGCGGGGAGG - Intergenic
1135547972 16:23378475-23378497 CAGGGTGGCCAGGCCCGCCGAGG + Intronic
1136547729 16:30965120-30965142 CGGGCAGGGGAGGCTGGGCGGGG - Exonic
1136588316 16:31202046-31202068 AGGGCAGGGCAGGCACGGCTTGG - Intronic
1136716860 16:32288664-32288686 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1136835236 16:33494909-33494931 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1137401361 16:48156441-48156463 AGGGGAGGGCAGGGGAGGCGAGG + Intergenic
1137617014 16:49854695-49854717 CGGGGAGAGGAGGCCAGGGGAGG + Intronic
1137617792 16:49857318-49857340 CGGCGGCGGCAGGCACGGCGCGG + Intronic
1138023151 16:53502845-53502867 CGGGGAGGGCGGGCACGGGCCGG + Intronic
1138658097 16:58502107-58502129 TAGGGAGGGCAGGCCCTGCCAGG - Intronic
1139493299 16:67298917-67298939 AGGGCAGGGCAGGCCAGGCCAGG - Intronic
1139976977 16:70820108-70820130 CAGGGAGTGAAGGCCAGGCGCGG - Intronic
1141116692 16:81315334-81315356 CGGGGCGGCCGGGCCGGGCGTGG + Intronic
1141116822 16:81315693-81315715 CGGGGACCGCGGGCCCGGCCTGG - Intronic
1141593312 16:85082729-85082751 CGGGGAGGGCGGCCCTGGGGAGG + Intronic
1141709302 16:85688767-85688789 TGGGGAGGGGAGGCCGGGCTGGG - Intronic
1141730902 16:85822270-85822292 CAGAGAGGCCAGGCCCTGCGGGG + Intergenic
1141954864 16:87364007-87364029 CGGGGAGGGCAGGGCTGGCGGGG + Intronic
1142031054 16:87838845-87838867 GGGCGAGGGCCGGCCCGGTGGGG - Intronic
1142209870 16:88803924-88803946 CGCGGAGTGCGGGCCTGGCGGGG - Exonic
1142288574 16:89182098-89182120 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288581 16:89182113-89182135 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288596 16:89182143-89182165 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288611 16:89182173-89182195 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288618 16:89182188-89182210 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288633 16:89182218-89182240 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288640 16:89182233-89182255 GGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142288647 16:89182248-89182270 TGGGGAGGGCAGGCTGGGGGAGG - Intronic
1142330508 16:89449501-89449523 GGGGGTGTGCAGGCCGGGCGTGG + Intronic
1142417178 16:89949101-89949123 CGGCGAGGTCGGGGCCGGCGGGG + Intronic
1203009567 16_KI270728v1_random:229123-229145 TGGGGAGGGCAGGGCCGGGCCGG + Intergenic
1203145408 16_KI270728v1_random:1795230-1795252 TGGGGAGGGCAGGGCCGGGCCGG - Intergenic
1142611058 17:1109378-1109400 CGGGAAGGGCGGGCCCTGCGGGG - Intronic
1142762893 17:2051754-2051776 CTGGGAGGGAAGGCCCAGCGGGG + Intergenic
1142764066 17:2056069-2056091 CGCGAAGGCCGGGCCCGGCGCGG - Intronic
1142764414 17:2057429-2057451 CTGGGAGGGCTGTCCGGGCGCGG - Exonic
1142883020 17:2895866-2895888 AGGGGAGGGCAGGCCGGGCGCGG - Intronic
1143098049 17:4488984-4489006 TGGGGAGGGCTGGCTCTGCGGGG + Intergenic
1143543529 17:7583159-7583181 CGGGGAGCCGAGGCCTGGCGAGG - Intergenic
1143629042 17:8126634-8126656 CGGGGCGGGCCGGCTGGGCGGGG + Intergenic
1144527206 17:16000048-16000070 CGGGCGGGGCCGGCCGGGCGGGG + Intronic
1144581392 17:16461440-16461462 CGGGAAGGGGAGGGCCGGCTGGG - Intronic
1144704820 17:17361559-17361581 GGGGGAGGACAGGCGCGGAGGGG + Intergenic
1144724799 17:17496476-17496498 CGGGGGAGGCGGGCCCCGCGGGG - Intergenic
1144822921 17:18088086-18088108 GGGTGAGGGCCGGCCGGGCGGGG + Exonic
1144953021 17:19004201-19004223 CGGGGAGGGCGGGCCGCGCGGGG + Intronic
1144967774 17:19088977-19088999 CGGGGCGGGAAGGCGAGGCGGGG - Intergenic
1144980142 17:19163086-19163108 CGGGGCGGGAAGGCGAGGCGGGG + Intergenic
1144988080 17:19215146-19215168 CGGGGCGGGAAGGCGAGGCGGGG - Intergenic
1146058669 17:29593458-29593480 CGGGGGCGGCGCGCCCGGCGCGG - Exonic
1147314441 17:39612805-39612827 AGGGGAGGGCAGGGCCAGTGAGG + Intergenic
1147327216 17:39675221-39675243 CGGGTTGGGCAGGCCCAGCCAGG - Intronic
1147726065 17:42566890-42566912 CGGGGAGGGCAGGCACGGCGGGG + Intergenic
1147740799 17:42670111-42670133 CGGGCGGAGCGGGCCCGGCGCGG - Exonic
1147743073 17:42679614-42679636 CGGCGGGGGCAGCCGCGGCGGGG + Exonic
1147757458 17:42778473-42778495 CTGGGAGCACAGGCCAGGCGCGG - Intronic
1147793630 17:43027844-43027866 CGGGGAGGAGAGGGCTGGCGTGG - Intronic
1147795181 17:43037131-43037153 GGCAGAGGGCAGGCCGGGCGTGG - Intergenic
1147900475 17:43780154-43780176 AGGGGTGGGCAGGCACGGGGTGG - Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1147987586 17:44315343-44315365 GGGGGCGGGCGGGCCGGGCGGGG + Intronic
1148159968 17:45444166-45444188 TGGGGAGGGAAGGCCAGACGGGG + Intronic
1148271738 17:46266953-46266975 TGGGGTGGGCAGGGCCGGCGGGG - Intergenic
1148281393 17:46350575-46350597 AGGGGGGGGGAGGCCAGGCGAGG + Intronic
1148460282 17:47835812-47835834 AGGGGAGGGCAGGCCCCACAGGG - Intronic
1148818314 17:50346292-50346314 GCGGGCGGGCAGGCCGGGCGCGG + Intronic
1149647296 17:58249694-58249716 TGGTGAGGGCAGGCCGGGCCGGG + Exonic
1149865673 17:60149865-60149887 AGGGGAGGGCAGGCCCCGCCAGG + Intergenic
1149963282 17:61136058-61136080 CGGGGAAGGCAGGCGCGAAGGGG - Intronic
1150249894 17:63699644-63699666 AGGGGAGGTCGGGGCCGGCGGGG + Intronic
1150256609 17:63750875-63750897 GGGAGAGGACAGGCCGGGCGTGG - Intronic
1150283461 17:63942798-63942820 CGGGGCGGGCTGGACCGGCAGGG - Intronic
1150391258 17:64791045-64791067 TGGGGAGGGAAGGCCAGACGGGG + Intergenic
1151666967 17:75550492-75550514 GGGGCGGGGCAGGCCGGGCGCGG + Intronic
1151938897 17:77281021-77281043 CGGGCGGGGCGGGCCCGGCCAGG - Intronic
1152293622 17:79454388-79454410 CGCAGAGGGCAGGCCAGGAGGGG - Intronic
1152353827 17:79797462-79797484 GGGGGAGGGGGGCCCCGGCGAGG - Intronic
1152546725 17:81004074-81004096 TGGGGAGCGGAGGCCAGGCGGGG - Intronic
1152552030 17:81034848-81034870 AGGAGAGGGGAGGCGCGGCGCGG - Intergenic
1152552313 17:81035697-81035719 CGGGCAGGGCCGGGGCGGCGGGG + Intronic
1152720946 17:81923641-81923663 CAGGGAGTGCGGGCGCGGCGGGG - Intronic
1152758699 17:82097683-82097705 TGGGGAGGCCGGTCCCGGCGCGG + Intronic
1152809901 17:82376412-82376434 TGGGGAGGGGAGGCCAGGCTGGG - Intergenic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1152925356 17:83085166-83085188 CGGGGACGGCAGGCCCGGCCGGG + Exonic
1152927030 17:83092113-83092135 GGGGGAGGCCAGGCCCCGCAGGG + Intronic
1153480820 18:5544128-5544150 CTGGGAGGGCAGGCAGGACGAGG - Exonic
1153489300 18:5630683-5630705 CGGGGAGGGCGGGCCCGCGAGGG - Intronic
1153565579 18:6414661-6414683 CGGCGAGGGCCGGGCCGGTGGGG - Intronic
1154255670 18:12779015-12779037 CGGCGTGGGGAGGCCTGGCGTGG - Intergenic
1154435003 18:14336105-14336127 CTGGGAGGTCAGGCCCTGTGAGG - Intergenic
1155221525 18:23689881-23689903 CGGGGAGAGGGGACCCGGCGAGG + Exonic
1155507890 18:26549422-26549444 CGGGGCTGGCTGGACCGGCGCGG - Exonic
1157354155 18:46917673-46917695 CGGGGAGGGAAGGCACGACCTGG - Intronic
1157544807 18:48539915-48539937 CGGGGAAGGGAGGGGCGGCGTGG - Intronic
1157572362 18:48721494-48721516 CGGGGAGGGCTGGGCTGGCTTGG - Intronic
1157849106 18:51030652-51030674 CGGGGTGCGCGGGCCCGGCCGGG - Intronic
1158505659 18:58044341-58044363 CGGGGAGGGAAAGCCCGGCCGGG + Intergenic
1159770762 18:72543459-72543481 AGGGGAGGGCAGGTCGGGGGTGG + Intronic
1160594376 18:79964054-79964076 AGGCCAGGGAAGGCCCGGCGTGG + Intergenic
1160658944 19:289437-289459 CAGAATGGGCAGGCCCGGCGTGG + Intronic
1160689295 19:453787-453809 CGTGGAGCCCAGGCCCGGTGGGG - Intronic
1160703146 19:517831-517853 TGGGGAGGGGAGGCCCGGGCTGG + Intronic
1160725470 19:616210-616232 CGGGCAGGGCGGGCCCAGCAAGG - Exonic
1160824848 19:1074736-1074758 CCGGGAGGGCGGGCTGGGCGGGG + Intronic
1160916547 19:1499395-1499417 CGGGGGCGGCTGGCCGGGCGGGG + Intergenic
1160919921 19:1514463-1514485 AGAGAAGGGCAGGCCGGGCGCGG + Intergenic
1160922400 19:1527034-1527056 CGGGGGGGGCAGGTGTGGCGGGG + Intronic
1160947199 19:1649135-1649157 CGGAGCAGGCAGGCCCGGTGGGG - Intronic
1161015420 19:1980641-1980663 AGGGGAGGGCAGGCCCGGCCTGG + Exonic
1161101685 19:2424740-2424762 AGGGGAGGGCAGGCGGGGGGCGG + Intronic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161195405 19:2983628-2983650 GGGGGAGGGCAGGCCACGCATGG + Intronic
1161250028 19:3275593-3275615 CAGGGAGGGCATTCCAGGCGGGG + Intronic
1161356342 19:3821282-3821304 GAGGGAGGGCAGGTCCAGCGTGG - Intronic
1161492995 19:4572564-4572586 AGTGGAGGGGAGGCCGGGCGCGG - Intergenic
1161593204 19:5137939-5137961 CTGGGAGGGCAGGTGCAGCGGGG - Intronic
1161664662 19:5568049-5568071 CGCAGTGGGCAGGCCCGGCCCGG + Intergenic
1161664665 19:5568054-5568076 TGGGCAGGCCCGGCCCGGCGGGG + Intergenic
1161695874 19:5767745-5767767 AAGGGAGGGCAGGCCAGGCGCGG - Intronic
1161770717 19:6229273-6229295 CGGGGAGGGCAGTGCCGGCGTGG - Intronic
1161779131 19:6279683-6279705 CGGGGAGGCCGGGACCGGGGAGG + Intronic
1161973400 19:7596176-7596198 CGGGGGCGGCGGGCCGGGCGCGG + Intronic
1162032955 19:7925230-7925252 CTCAGAGGGCCGGCCCGGCGGGG - Exonic
1162344391 19:10111073-10111095 CAGGGAGCCCAGGCCAGGCGGGG + Exonic
1162497614 19:11032150-11032172 TGGGGAGGGCTGGCCCTGCCAGG + Intronic
1163051850 19:14690184-14690206 CGGGGAGGGCTCGGCTGGCGCGG + Intronic
1163146000 19:15379664-15379686 CGGGGAGGGAAGGCTCTGTGCGG - Intronic
1163158095 19:15449777-15449799 CGGTGAGGCCCGGCCCGGCCTGG - Exonic
1163554056 19:17982686-17982708 CAGGGAGAACGGGCCCGGCGGGG + Intronic
1163783300 19:19261627-19261649 TGGGGAAGGCAGGCCCGGGAGGG - Intronic
1164120556 19:22261751-22261773 CGGGGCGGGCGGGGCGGGCGGGG + Intergenic
1164270604 19:23668790-23668812 CGGGGCGGGCAGGGCCGGCCGGG + Intronic
1164594820 19:29526017-29526039 CGGGGAGAGCGGGTCCGGCGTGG - Intergenic
1165227646 19:34365795-34365817 CAGGGCGGGCAGCCCGGGCGGGG + Intronic
1165450603 19:35879917-35879939 CGGGAAGGGCTGGCGCGCCGGGG + Intergenic
1165461100 19:35944913-35944935 CGGGGCGGGCGGGGCGGGCGTGG - Exonic
1165728488 19:38129243-38129265 CCTGGAGGCCAGGCCCTGCGTGG + Intronic
1165738570 19:38192756-38192778 CGAGTAGGGCAGGCCTGGCTGGG - Intronic
1165744767 19:38224173-38224195 CTGGGAGGACCGACCCGGCGGGG - Exonic
1165805888 19:38580319-38580341 GGGGGAGGGCAAGCCCAGGGCGG + Intronic
1165998012 19:39858862-39858884 AGGGGAGGGGAAGCCCGCCGGGG + Intergenic
1166064353 19:40348399-40348421 CGGGGCGGGCAGCCCGGGCCGGG - Intronic
1166214212 19:41325185-41325207 CAGGGAGGGCGGGCCCCGCTGGG + Intronic
1166294665 19:41883142-41883164 CGGGGAGGGGCGGCGGGGCGGGG + Intronic
1166549937 19:43658649-43658671 CGGGGAGGGCATGCCAAGCATGG - Intronic
1166911311 19:46160332-46160354 CAGGGAGGGCAGGCCAGGGTGGG - Intronic
1167492234 19:49799513-49799535 GGGGGGTGGCAGGCCCGGGGTGG - Intronic
1167703503 19:51065083-51065105 AGGGGAGGGCAGGGCGGGCGGGG + Exonic
1168645907 19:58059331-58059353 GGGGGAGGGGAGGCCAGGCCGGG + Intronic
1168645909 19:58059336-58059358 AGGGGAGGCCAGGCCGGGCCGGG + Intronic
1168650689 19:58090199-58090221 CGGCGTGGGCAGATCCGGCGGGG + Exonic
925370119 2:3338537-3338559 TGGGGAGGGCAGGCGCAGCAGGG + Intronic
926077208 2:9951313-9951335 CGGGGACGGCGGGGACGGCGGGG + Intergenic
926077213 2:9951322-9951344 CGGGGACGGCGGGGGCGGCGGGG + Intergenic
926161730 2:10494532-10494554 CGGGGAGGCCAGGGCTGGGGCGG + Intergenic
926718582 2:15942571-15942593 CGGGCAGGGCGGCCCCGGCGCGG - Exonic
927523891 2:23720281-23720303 CCAGGAGGGCAGGCCAGGTGTGG + Intergenic
927896393 2:26785479-26785501 CGGGGACGGCGGGATCGGCGGGG - Intronic
927936842 2:27080879-27080901 TGGGGCGGGCAGGCCGGGCCAGG - Exonic
927964878 2:27262516-27262538 CAGGGAAGGCAGGCGCCGCGGGG + Intronic
931270431 2:60697162-60697184 AGGAGAGAGCAGGCCGGGCGTGG - Intergenic
931467663 2:62505819-62505841 CGCGGAGACCAGGCCCGGCCGGG + Intronic
931681284 2:64751456-64751478 AGGGGAGGGCTGGCCCGGAGAGG - Intergenic
932002365 2:67896426-67896448 AGGGGTGGGCAGGACCAGCGTGG - Intergenic
932331537 2:70900816-70900838 CGGGCAGCCCGGGCCCGGCGAGG + Exonic
932362198 2:71118307-71118329 TGGGGAGGGCACGCCCAGCATGG - Intronic
934604344 2:95682750-95682772 AGGGGAGGGCGGGCCCGAGGGGG - Intergenic
934655986 2:96116962-96116984 CAGGGAGGGCAGGGCGGGCGTGG + Intergenic
934688090 2:96335998-96336020 GGGGGAGGGGAGGGCCGGCGCGG + Intronic
934688093 2:96336003-96336025 AGGGGAGGGCCGGCGCGGGGCGG + Intronic
934770848 2:96906952-96906974 CGAGGAGGGCCTGCCCGGCCCGG + Intronic
935163311 2:100548043-100548065 TGGGGAGGGCATGCACGGGGGGG + Intergenic
935284192 2:101549351-101549373 CAGGGAGGGGAAGCCAGGCGGGG - Intergenic
936020153 2:108988580-108988602 TGGGGAAGGCAGGCGCGGCAGGG - Intronic
936090495 2:109498834-109498856 GGGAAAGGGCAGGCCCGGCGTGG + Intronic
936585806 2:113756658-113756680 CGCGGAGGGCAAGCCGGGGGCGG - Exonic
936985774 2:118310486-118310508 CGGGGAGGGGAGCCCGGGAGGGG - Intergenic
937121474 2:119442409-119442431 TGGGGAGGGCAGGCCCGTAAGGG - Intronic
937182980 2:120012927-120012949 CGGCGAGGCCGGGCCCGGCCGGG - Intergenic
937494105 2:122400024-122400046 AAGGAAGGGCAGGCCAGGCGTGG + Intergenic
937895931 2:126976807-126976829 CGGGCAGGGCAGGGCCAGCAGGG - Intergenic
938079681 2:128363067-128363089 CGGGGAAGGCAGGAGCGGTGCGG + Intergenic
938278956 2:130051354-130051376 CTGGGAGGTCAGACCCTGCGAGG + Intergenic
938302955 2:130229177-130229199 CGGTGCGGGCAGCCCCGGTGGGG - Intergenic
938329939 2:130442229-130442251 CTGGGAGGTCAGGCCCTGCGAGG + Intergenic
938360006 2:130679274-130679296 CTGGGAGGTCAGGCCCTGCGAGG - Intergenic
938436414 2:131285995-131286017 CTGGGAGGTCAGGCCCTGCGAGG - Intronic
938453711 2:131445045-131445067 CGGTGCGGGCAGCCCCGGTGGGG + Intergenic
938765616 2:134459156-134459178 AGGGGAAGCCAGGCCTGGCGTGG - Intronic
940635616 2:156293705-156293727 CGGGGGCGGCTGGCCGGGCGGGG - Intergenic
940775145 2:157876544-157876566 CGGCGCGGTCAGGCTCGGCGGGG - Intergenic
940830268 2:158457781-158457803 AGGGGTGGGCAGGACCGGCAAGG - Intronic
941384853 2:164841103-164841125 CGGGGAGGGCGAGGCCGGCGAGG - Intronic
943680361 2:190761218-190761240 CGGGGCCGGCAGGGCCGGCCGGG + Intergenic
944413766 2:199464237-199464259 CGGGGAGGGAAGGCACCACGGGG - Intronic
944513720 2:200490199-200490221 GGGGGAGGGCAGGCAAGGCGCGG + Exonic
946019982 2:216634108-216634130 CGCGGAAGTCAGGCCCGGGGAGG + Intronic
946199925 2:218065473-218065495 TGGGGCTGGCAGGCCCGGCAAGG - Intronic
946248107 2:218398585-218398607 CGGGGAGGGGAGGCCCCGCGCGG - Intronic
946257648 2:218457755-218457777 TGGGGAAGGAAGGCCAGGCGTGG + Intronic
946279666 2:218657718-218657740 TCGGGAAGCCAGGCCCGGCGCGG - Intronic
946622355 2:221573283-221573305 CAGGGAGGGCTGCCCCGGCTAGG - Intronic
947506765 2:230713382-230713404 CGGAGAGGGCAGGCTGGGCCCGG - Intronic
947795319 2:232890695-232890717 CGGGGAGTGGGGGCCCGGCAGGG - Intronic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948050368 2:234975317-234975339 TGGGGAAGCCAGGCCTGGCGAGG + Intronic
948060561 2:235040840-235040862 TGGTGAGGGCAAGGCCGGCGGGG - Intronic
948503567 2:238411825-238411847 CGGGGAAGGCAGGATCGGGGGGG + Intergenic
948619520 2:239225613-239225635 AGGGGAGGGCAGGCCCGCCCAGG + Intronic
948748141 2:240110496-240110518 CGGGCATGGCAGGCCCTGCCTGG - Intergenic
948835399 2:240623906-240623928 CAGGGAGGCCAGGCCTGGTGGGG + Intronic
948844708 2:240677498-240677520 CCAGGAGGGCAGGCCCAGGGAGG + Intronic
948849152 2:240697381-240697403 CCAGGAGGGCAGGCCCAGGGAGG - Intronic
948886396 2:240887266-240887288 CGGGGCAGGAAGGCCCGGCATGG - Intronic
949019749 2:241734532-241734554 CCTGGAGGGCAGGCGGGGCGGGG + Intergenic
1168769806 20:408032-408054 CGGGGTGGGCGGGGCCGGGGCGG - Exonic
1168800596 20:641936-641958 CTGGGGGGGGAGGCCCAGCGGGG + Intergenic
1168800613 20:641970-641992 TGGGGGGGGGAGGCCCAGCGGGG + Intergenic
1168800691 20:642129-642151 CTGGGGGGGGAGGCCCAGCGGGG + Intergenic
1168800708 20:642163-642185 TGGGGGGGGGAGGCCCAGCGGGG + Intergenic
1169001097 20:2168574-2168596 GGGGCATGGCAGGCCGGGCGCGG + Intronic
1169088362 20:2840930-2840952 CGGGGAGAGCCGGCGCGGGGCGG - Intronic
1169164112 20:3407679-3407701 CGCGGCGCGCGGGCCCGGCGGGG + Intergenic
1170775451 20:19371316-19371338 TGGAGAGGGCAGGCCCTGGGAGG + Intronic
1171880775 20:30616323-30616345 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1172118012 20:32583421-32583443 CGGGGCGGGCGGGCCGGCCGGGG + Intronic
1172284688 20:33732254-33732276 CGGGGAGAGCCAGGCCGGCGGGG + Intronic
1172349905 20:34230758-34230780 CGGGGGGGTCAGCCCCGGCCAGG - Intronic
1173672913 20:44810414-44810436 CGGGGCTGGCGGGCGCGGCGGGG + Intergenic
1174077492 20:47948272-47948294 CGGCTGGGGCAGGCCGGGCGCGG + Intergenic
1175399504 20:58692673-58692695 GGGTGCGGGCAGGCCCGGCCGGG - Exonic
1175429500 20:58891616-58891638 CCGGGCGGGCGGGCCGGGCGCGG - Intronic
1175877816 20:62238685-62238707 CGGGGAGGGGAGGGCGGGCCGGG + Intronic
1175927044 20:62476054-62476076 CGGGGAGGGAAGGGGCGGCGCGG - Intergenic
1175945477 20:62556568-62556590 AGGGGAGAGCAGGCAGGGCGGGG + Intronic
1176020263 20:62959060-62959082 AGGGGAGGACAGGCCTGGCGGGG + Intronic
1176080968 20:63272890-63272912 AGGGGCGGGCAGGGCCGCCGGGG - Exonic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176428780 21:6563901-6563923 CGGGGATGGCTCGCTCGGCGTGG - Intergenic
1176842035 21:13849597-13849619 CTGGGAGGTCAGGCCCTGTGAGG + Intergenic
1179243841 21:39613096-39613118 CGGGGAGCGCTGGCCGGGAGCGG + Intronic
1179704270 21:43172217-43172239 CGGGGATGGCTCGCTCGGCGTGG - Exonic
1180253607 21:46606578-46606600 TGCAGAGGGCAGGCCCGGCTGGG - Intergenic
1180855270 22:19041373-19041395 CAGGGACGGCAGGCCCAGCCTGG - Intronic
1180866420 22:19122433-19122455 CGGGGCGGGGCGGCGCGGCGCGG - Exonic
1181026879 22:20131891-20131913 CCGGGCGGGCAGGGCCGGCCGGG - Intronic
1181029519 22:20143100-20143122 CTGGGTGGGCAGGGCAGGCGTGG - Exonic
1181133997 22:20751600-20751622 CAGGGCGGACAGGGCCGGCGGGG + Intronic
1181876765 22:25945938-25945960 AGGGGAGGGGAGGCGAGGCGAGG - Intronic
1182236971 22:28883726-28883748 CGCGGAGGGCGGGCGCGGCCGGG - Exonic
1182278683 22:29205976-29205998 CGGGGAGGACAGGCTGGGGGCGG + Exonic
1182446450 22:30392564-30392586 AGGGGAGGGGAGGGCCGGAGGGG - Intronic
1182477080 22:30582191-30582213 TGGGAAGGCCAGGCCCAGCGGGG + Intronic
1184276454 22:43411878-43411900 CGGGGAGGGCGGGCGTGGGGAGG + Intronic
1184361984 22:44024347-44024369 CGGGGTGGGCGAGCGCGGCGCGG - Intronic
1184405586 22:44298771-44298793 CGGGGAGGGCAGGCCCGGCGAGG + Intronic
1184680948 22:46071841-46071863 CGGAGAGGGCGAGCGCGGCGCGG - Intronic
1184795128 22:46727833-46727855 CGGGGGTGGCAGGGCCGGGGGGG - Intronic
1184989088 22:48155154-48155176 TGGGGAGGGCAGGCCAGGCCAGG + Intergenic
1185149253 22:49154638-49154660 TGGGGCGTGCAGGCCTGGCGGGG + Intergenic
1185213876 22:49587510-49587532 TGGGGAGGGCGGGCCTGGAGGGG - Intronic
1185333352 22:50261334-50261356 CGGGGCGGGCGGGGCCTGCGCGG - Intronic
1185342732 22:50298999-50299021 GTGGGAGGGCAGGCCCAGCTTGG + Intronic
1185351435 22:50341702-50341724 AGGAGAGGGCTGGCCGGGCGCGG + Intergenic
1185376741 22:50486135-50486157 CGGGGTCGGCGGGCCCAGCGAGG - Exonic
1185413486 22:50697735-50697757 GCGGGGGGGCGGGCCCGGCGCGG + Intergenic
949474830 3:4433535-4433557 CGGGAAGGGCAGGCCAGGGCTGG - Intronic
949601052 3:5598205-5598227 CAGGCCGGGCAGGCCGGGCGTGG + Intergenic
950024279 3:9809979-9810001 CTGGGAGGGCGAGCGCGGCGAGG + Exonic
950453204 3:13077339-13077361 GGAGGAGGGCAGGGCTGGCGAGG - Intergenic
950831182 3:15877923-15877945 CGGGCTGGGCAGGCCAGGGGCGG - Intergenic
954160065 3:48714711-48714733 AAGGTAGGGCAGGCCAGGCGCGG + Intronic
954465511 3:50652255-50652277 GGGGGAGGGCAGGCCGTGTGTGG + Intergenic
956604974 3:71064967-71064989 CGGGGCGGGTGGGCGCGGCGCGG - Intronic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
956761345 3:72447348-72447370 CGGAGCGTGCAAGCCCGGCGGGG + Intergenic
959085648 3:101849152-101849174 CCGGGCGCCCAGGCCCGGCGGGG + Intronic
959783682 3:110267450-110267472 GGGGGAGGCAAGGCCAGGCGGGG - Intergenic
960163890 3:114380308-114380330 CAGGCAGGGAAGGCCCGGCTTGG + Exonic
961077042 3:123992049-123992071 CGGGGAGGGCAGCAGCGGCCGGG + Intronic
961307534 3:125969251-125969273 CGGGGAGGGCAGCAGCGGCCGGG - Exonic
961376445 3:126469296-126469318 TGGGGAGAGCAGGCCAGGCAGGG - Intronic
961446494 3:126983792-126983814 CGGGGTGGCCAGGCCCGGATAGG + Intergenic
962756315 3:138467857-138467879 AGGGGAGGGCAGGCTGGGCCTGG + Intronic
964801589 3:160564915-160564937 CGCGGCGGGGAGGCCGGGCGCGG - Intronic
965109441 3:164402153-164402175 CAGGGCCGGCAGGTCCGGCGGGG + Intergenic
966133524 3:176671866-176671888 AGGGGAGAGTAGGCCGGGCGCGG + Intergenic
966390928 3:179451557-179451579 CGAGGCGCGCGGGCCCGGCGGGG + Exonic
966768068 3:183479984-183480006 CTGGGAGGGGAGGCCTGGCAGGG + Intergenic
966911400 3:184562183-184562205 CGGCGCGGCCCGGCCCGGCGCGG + Exonic
967858390 3:194134696-194134718 CGGGGAGCGCACACCCGGGGTGG - Intergenic
967859634 3:194141366-194141388 CCGCCAGGGCTGGCCCGGCGTGG - Intergenic
968047019 3:195630204-195630226 CGGGGAGGGGCGGCCCTGAGTGG + Intergenic
968230728 3:197003267-197003289 CGCGAAGGCCGGGCCCGGCGTGG - Exonic
968307632 3:197659840-197659862 CGGGGAGGGGCGGCCCTGAGTGG - Intergenic
968433822 4:575200-575222 CGGGGCCGGCGGGGCCGGCGGGG - Intergenic
968674673 4:1871212-1871234 CGGGGCGGGCAGGCACGCGGCGG - Intergenic
968729123 4:2261535-2261557 CGGCGAGGGCGGGGCCGGCCGGG + Intronic
968737572 4:2305196-2305218 AGCGGAGGGCAGCCCAGGCGGGG - Exonic
968872624 4:3249480-3249502 CGGCGAGCGCAGGCTGGGCGAGG + Exonic
969689379 4:8695874-8695896 TGGGGCGGGCAGGGCAGGCGGGG + Intergenic
972579902 4:40385950-40385972 AGGGGAGGGGAGGCCAGGGGAGG + Intergenic
972654137 4:41049382-41049404 AGGGGAGGGCTGGCTGGGCGGGG - Intronic
972817170 4:42657114-42657136 CGCGGAGGGGCGGCTCGGCGAGG + Intergenic
973981919 4:56314669-56314691 TGGGGAGGGCCGGCGGGGCGCGG + Exonic
975779014 4:77819761-77819783 CGGGGCGGGCGGGCCGGGCCGGG + Intergenic
978503668 4:109434176-109434198 GGGGCAGGGAAGGCACGGCGCGG + Intronic
983449305 4:167890847-167890869 TAGGGAGGGAAGGCCAGGCGCGG + Intergenic
984167525 4:176320288-176320310 CCGGCACGGCAGCCCCGGCGCGG - Intronic
984206521 4:176792982-176793004 AGGGGAGGGCAGCCCGGGCTCGG - Intergenic
984756740 4:183331661-183331683 CGTGGAGGGGAGGCCTGCCGTGG + Intergenic
984889047 4:184474918-184474940 CGGGGGGCGCAGGCCCGCGGCGG + Intergenic
984928377 4:184826082-184826104 GCGGGAGGGCGGGGCCGGCGCGG - Intronic
984999657 4:185471207-185471229 CGGGGAGGGCGGGGAGGGCGGGG + Intronic
985068255 4:186144330-186144352 CCGGTAGGGCAGGACGGGCGTGG + Intronic
985550109 5:528573-528595 CGGGGCGGGCGGGGCGGGCGGGG - Intergenic
985652182 5:1112328-1112350 CGGGGAGGGCGGGGAGGGCGGGG - Intergenic
985660854 5:1155905-1155927 CGGGGAGGGCGGGGCCGGCGGGG + Intergenic
985713754 5:1444854-1444876 CAGGGCGGGGAGGCCGGGCGAGG - Intronic
985744601 5:1638940-1638962 CGGGGAGGGGTGGCCCTGAGTGG - Intergenic
985780385 5:1867898-1867920 CGGGGACGGCGGGGACGGCGGGG - Intergenic
985780389 5:1867907-1867929 CGGGGACGGCGGGGACGGCGGGG - Intergenic
985780393 5:1867916-1867938 CGGGGACGGCGGGGACGGCGGGG - Intergenic
985953750 5:3244360-3244382 TGGGGAGGTTAGGCCGGGCGCGG - Intergenic
986018539 5:3779538-3779560 GGAGGAGGGCTGGCCCGGAGTGG + Intergenic
986608648 5:9546242-9546264 CGGGGAGGTCAGGCGCGGGTGGG - Intergenic
987050430 5:14143635-14143657 CGGCGCCGCCAGGCCCGGCGCGG + Intergenic
992939511 5:81750031-81750053 CGGGAGGGGCGGGCCCGGCGGGG - Intronic
994367006 5:98928459-98928481 GGCGGAGGGCGGGCGCGGCGCGG - Intronic
997201291 5:132011573-132011595 CGGGGAGGCCGGGCCGGGCCGGG - Exonic
998133165 5:139661157-139661179 CGGCGCGGGCAGCCGCGGCGGGG - Intronic
998822211 5:146067255-146067277 CGGGGAAGGCAGGCCTGGTGTGG - Intronic
1000060459 5:157651394-157651416 CGAGGACTGCAGGCTCGGCGCGG - Exonic
1000065456 5:157690216-157690238 CGAGGACTGCAGGCTCGGCGCGG - Intergenic
1000319066 5:160119322-160119344 CGGGGAGGGGGGCGCCGGCGAGG - Exonic
1001392290 5:171388525-171388547 GGGGGTGGGGAGGCGCGGCGCGG + Intronic
1001605154 5:172954465-172954487 CGGTGGGGGCAGGGGCGGCGGGG + Intergenic
1001959834 5:175873055-175873077 GGGGGAGGGGAGGCCGGGGGCGG - Intronic
1002076704 5:176712688-176712710 ATGGGAGGGCAGGCCAGCCGGGG + Intergenic
1002559436 5:180071670-180071692 CGGGGCGGGCGGGCCCTGCCCGG - Exonic
1002697079 5:181098535-181098557 AGGGGAGGGGAGGGCAGGCGAGG + Intergenic
1002697082 5:181098540-181098562 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002697097 5:181098570-181098592 AGGGGAGGGGAGGGCAGGCGAGG + Intergenic
1002697100 5:181098575-181098597 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002697132 5:181098635-181098657 AGGGGAGGGGAGGGCAGGCGAGG + Intergenic
1002697135 5:181098640-181098662 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002697172 5:181098710-181098732 AGGGGAGGGGAGGGCAGGCGAGG + Intergenic
1002697175 5:181098715-181098737 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002697181 5:181098730-181098752 AGGGGAGGGGAGGGCAGGCGAGG + Intergenic
1002697184 5:181098735-181098757 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002697190 5:181098750-181098772 AGGGGAGGGCAGGCGAGGGGAGG + Intergenic
1002788888 6:424322-424344 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002788906 6:424360-424382 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002788924 6:424398-424420 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002788942 6:424436-424458 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002788960 6:424474-424496 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002788996 6:424550-424572 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002789014 6:424588-424610 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002789032 6:424626-424648 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002789068 6:424702-424724 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1002789086 6:424740-424762 GAGGGCGGGAAGGCCCGGCGGGG - Intergenic
1003012229 6:2436664-2436686 AGGGGAGGGCAAGCCGGGCGGGG - Intergenic
1003099044 6:3163151-3163173 CGGGGCGGGCAGGGCCTCCGGGG - Intergenic
1003478255 6:6505226-6505248 AGGGGAGCAAAGGCCCGGCGAGG + Intergenic
1003824949 6:9942457-9942479 GGGCGAGGGCAGGGGCGGCGAGG - Intronic
1004044558 6:12012062-12012084 CGGGGCGGGAAGGACGGGCGCGG - Intronic
1005851725 6:29827959-29827981 AGGGAGGGGCCGGCCCGGCGGGG + Intronic
1006103743 6:31703321-31703343 CAGGGAGGGCGGGGCCGGCAGGG - Exonic
1006333819 6:33410568-33410590 CGGGGAGGGCGGGGCGCGCGAGG + Intronic
1006375799 6:33671083-33671105 CGTGGAGGGCAGGCCAGGACTGG - Intronic
1006860693 6:37170096-37170118 CGGGGAGGGCGCGGCGGGCGGGG - Intergenic
1006860910 6:37170899-37170921 TGGGGAGGGCGCGCCGGGCGGGG + Intronic
1006898263 6:37484324-37484346 GGTAGAGGCCAGGCCCGGCGGGG - Intronic
1007374903 6:41449873-41449895 AGTGGAGGGCAGGCCAGGCATGG + Intergenic
1007759743 6:44127158-44127180 CGGGGAGGGGGGTCCCGACGGGG - Intronic
1007967648 6:46016417-46016439 CGGGCAGGGCAGGGCAGGGGTGG + Intronic
1010378949 6:75205385-75205407 CGGGGAGGGCAGGCGTGCGGCGG - Intronic
1010921443 6:81686580-81686602 TGGAGGGGGCAGGGCCGGCGGGG + Intronic
1011734484 6:90297190-90297212 CGGGAAGGCCAGGCCGAGCGGGG - Intergenic
1012503422 6:99916252-99916274 TGAGGAGAGGAGGCCCGGCGTGG + Intergenic
1013155557 6:107489447-107489469 CGTGGAGGACCGGCCGGGCGGGG + Intergenic
1014272561 6:119349910-119349932 CGGGAAGCGCAGCCTCGGCGGGG + Intergenic
1014383098 6:120768490-120768512 AGGGGAAGCCAGGCCGGGCGCGG - Intergenic
1016010604 6:139134950-139134972 CGAGGTGGGCAGGCCCCGCGCGG + Intergenic
1018613294 6:165662887-165662909 AGGGGTGGGCAGGTCCTGCGGGG - Intronic
1018849718 6:167578242-167578264 CGGGGAGGCCAGGGCCGTGGCGG + Intergenic
1018852742 6:167652976-167652998 AGGGGAGGGCAGGTGAGGCGGGG + Intergenic
1018911197 6:168101605-168101627 CGGGGAGGGTCGGCTGGGCGGGG - Intergenic
1019323317 7:425288-425310 TGGGGAGGGCAGGGCCGGAGCGG + Intergenic
1019341271 7:510231-510253 CGGGAAAGGCAGGGCCGGCCGGG - Intronic
1019509080 7:1408166-1408188 AGGGGAGGGCAGGCCGGGCCTGG + Intergenic
1019515365 7:1437654-1437676 CGGGCTGGGCGGGCCAGGCGGGG - Intronic
1019515406 7:1437820-1437842 CGGGCTGGGCAGGCCAGGCGGGG - Intronic
1019575448 7:1735513-1735535 CTGGGAGGGCTGACTCGGCGGGG - Intronic
1019594443 7:1851949-1851971 CGGGGAGGCAGGGCCCGGCACGG + Intronic
1019930692 7:4221058-4221080 CAGGGAGGCAAGGCCGGGCGTGG - Intronic
1020003104 7:4766701-4766723 CGGGGAGGCGAGGCCCAGCTGGG - Exonic
1020252938 7:6483939-6483961 CGGCGGGGGAAGGCCCGGAGAGG - Intronic
1021890184 7:25180001-25180023 CGGGGAGGGGAGGGGAGGCGCGG - Intronic
1024579991 7:50793488-50793510 CGGGGAGGGCGGGCGGGGCCGGG - Intergenic
1025211205 7:57020408-57020430 GGTGGAGGGCGGGGCCGGCGGGG - Intergenic
1025660750 7:63556439-63556461 GGTGGAGGGCGGGGCCGGCGGGG + Intergenic
1027539984 7:79454014-79454036 AGGGGAGCCTAGGCCCGGCGTGG + Intergenic
1028796398 7:94908097-94908119 CGGGGAGGGTCGGGCCGCCGCGG - Intronic
1030348246 7:108456457-108456479 CGGAGAGGGCGGGAGCGGCGGGG - Intronic
1032191294 7:129767389-129767411 CGGGGAGGGCAGGCCACATGAGG + Intergenic
1032344439 7:131106176-131106198 CGGGGAACGCCGGCCCTGCGTGG + Intergenic
1033253009 7:139777326-139777348 CGGGGAGGGCAGGGACGCCGGGG - Intronic
1033989074 7:147262512-147262534 CAGGGAGGCCGGGCCTGGCGCGG + Intronic
1034182195 7:149147612-149147634 CGGGGAAGGCAGGGCCGGGTCGG + Exonic
1034264050 7:149772921-149772943 AAGGGAGGGCAAGGCCGGCGCGG - Intronic
1034348463 7:150401396-150401418 GGGAGAGGGCAGGCCCCTCGTGG + Intronic
1034469786 7:151248984-151249006 CGGGGAGGGGACGCCAGGGGAGG + Intronic
1034724174 7:153319936-153319958 CAGAGAGGGCAGGCCCTGCAAGG - Intergenic
1034776250 7:153829502-153829524 AGAGGAGGACAGGCCGGGCGTGG - Intergenic
1034958443 7:155350276-155350298 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958469 7:155350348-155350370 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958484 7:155350384-155350406 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958529 7:155350492-155350514 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958559 7:155350564-155350586 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958589 7:155350636-155350658 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958619 7:155350708-155350730 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1034958634 7:155350744-155350766 CCGGGAGGGGAGGCCGGCCGGGG - Intergenic
1035060674 7:156067014-156067036 CGGGGAGGTCAACCCCGGCAGGG + Intergenic
1035747749 8:1974089-1974111 CGGGGAGGGGAGGCCGGCAGGGG + Intronic
1036398250 8:8386554-8386576 CGGGGCGCGCGGGCCAGGCGGGG - Intergenic
1036665542 8:10734781-10734803 CGGGGCTGGCAGGCCTGGCCGGG - Intronic
1036768283 8:11562835-11562857 CGGGGCGGCCAGGCATGGCGGGG - Intronic
1037482102 8:19314216-19314238 CGGGGAGTGCAGGCCCCGGGAGG + Intronic
1037769634 8:21790737-21790759 CAGGGAGGGCAGGCCTGAAGGGG - Intronic
1037797655 8:22010201-22010223 CGGGGAGGTCAGGCCAGGTGGGG - Intergenic
1037807417 8:22066430-22066452 CGGGGAGGGCAGGTGCGGCGGGG + Intronic
1037936898 8:22921066-22921088 AGGGCAGGGCAGGCCGGGCTGGG + Intronic
1037981816 8:23259753-23259775 CAGGGAGGGCAGGCTAGGAGAGG - Intronic
1038010865 8:23474937-23474959 AGAGGAGGGCAGGCCAGGCATGG - Intergenic
1038828463 8:31032890-31032912 CGGGGGAGCCGGGCCCGGCGTGG - Exonic
1041504233 8:58576902-58576924 CTGGGTGGGCAGGCAGGGCGGGG - Intronic
1041673601 8:60516815-60516837 CGGGCAAGGCAGGCGCGGGGCGG + Intergenic
1045319541 8:101071499-101071521 CGGGCAGGACAGGCCAGGTGCGG + Intergenic
1045510821 8:102810756-102810778 CGGGGAGGGCGGGGAGGGCGCGG + Intergenic
1046103869 8:109644579-109644601 CGGGGAAGGCGGGCACTGCGGGG - Intronic
1048992088 8:139766371-139766393 CAGGGAGGCCAGGCCCAGCCTGG - Intronic
1049109716 8:140635412-140635434 CGTGGTTGGCGGGCCCGGCGCGG - Intronic
1049241328 8:141538875-141538897 CGGGTAGGGCAGGGCAGGAGAGG - Intergenic
1049292564 8:141812396-141812418 CGGGGAGGGCGGGGAGGGCGGGG + Intergenic
1049396584 8:142403662-142403684 GGGGGCTGGCAGGCCCCGCGGGG + Intergenic
1049408976 8:142464096-142464118 CGGGCAGGGCCGGCCCGGTGGGG - Exonic
1049441946 8:142613644-142613666 CGGGCAGCCCAGCCCCGGCGTGG - Exonic
1049537405 8:143188767-143188789 CAAGGAGGGCAGGGCCGGCTGGG + Intergenic
1049619183 8:143590157-143590179 CGGGGAGGGCGGGCACGGGGAGG - Intronic
1049619191 8:143590172-143590194 CAGGGAGGGCAGCCACGGGGAGG - Intronic
1049756620 8:144313771-144313793 CGGGGCGGGGAGGCGGGGCGGGG - Intronic
1049756627 8:144313784-144313806 CGGGGCGGGGAGGCGGGGCGGGG - Intronic
1049769840 8:144374697-144374719 AGGGCAGGGCAGGCCCGGCGGGG - Intronic
1049773912 8:144396072-144396094 TGTGGAGGCCAGGCCCTGCGAGG + Intronic
1049819049 8:144623054-144623076 CGGGGAGGGCAAGTCCTGTGTGG + Intergenic
1050382300 9:5042671-5042693 GTGGGAGGGCAGGCCTGGCCTGG + Intronic
1051235365 9:14993361-14993383 CTGGAAGCGCAGGCCCGGCGCGG + Intergenic
1053066401 9:35072262-35072284 CGCGCAGGGTAGGCCCGGCGGGG - Intronic
1053175381 9:35918587-35918609 TTGGCAGGGCAGGCCGGGCGCGG - Intergenic
1053495243 9:38544543-38544565 CTGGGAGGTCAGACCCTGCGAGG + Intronic
1053666949 9:40323479-40323501 CTGGGAGGTCAGGCCCTGCGAGG - Intronic
1053916541 9:42948588-42948610 CTGGGAGGTCAGACCCTGCGAGG - Intergenic
1054378100 9:64463507-64463529 CTGGGAGGTCAGACCCTGCGAGG - Intergenic
1054517660 9:66052804-66052826 CTGGGAGGTCAGACCCTGCGAGG + Intergenic
1054876255 9:70099682-70099704 AAGGTAGGGCAGGCCAGGCGCGG + Intronic
1056135052 9:83623114-83623136 CGGGTAGGCCGGGGCCGGCGGGG + Intronic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1057037322 9:91820808-91820830 AGGGGAGGTCAGGCCAGGTGTGG + Intronic
1057961073 9:99457781-99457803 AGGGGAGGGCAGGGCAGGGGAGG + Intergenic
1058707534 9:107649856-107649878 CTTGGAGGGCAGGCCGGGGGAGG - Intergenic
1060218940 9:121754428-121754450 GGGGCAGGGCAGGCCCAGGGAGG - Intronic
1060596185 9:124850538-124850560 CCTGGAGGGCAGGCACGGCGCGG + Intergenic
1061422707 9:130480759-130480781 TGGGGTGGGCAGGCCGGGTGTGG + Intronic
1061450242 9:130663746-130663768 CGGGGAGTGCAGGGCCGGAGAGG + Intergenic
1061859354 9:133460217-133460239 CGAGGAGCGCATGCGCGGCGGGG - Intronic
1062055855 9:134469498-134469520 CAGGGAGGGCAGGCAGGGCAGGG - Intergenic
1062067653 9:134537370-134537392 TGGGGAGGGCAGGCAGGGCCAGG + Intergenic
1062382727 9:136295180-136295202 CGTGGAGGGGAGCCCCGGTGGGG + Intronic
1062392308 9:136338726-136338748 CGCGGCGGGCAGACCCGGCCCGG + Intronic
1062435782 9:136546076-136546098 CGGGCGGGGCGGGGCCGGCGGGG - Intergenic
1062478488 9:136741074-136741096 CCGGGAGGGGAGGCCCCGGGAGG - Intronic
1062519007 9:136949972-136949994 TGGGGTGGGCGGGCCGGGCGCGG - Intronic
1062547125 9:137068927-137068949 CAGGGAGGCCAGGGCCGCCGTGG + Intronic
1062554315 9:137107121-137107143 CTGGGAGGGGAGGCCACGCGAGG - Intronic
1062690156 9:137837511-137837533 CGGGGAGTGCAGGCCTGGGAAGG + Intronic
1062696238 9:137877698-137877720 CAGGGTGGGCGGGGCCGGCGCGG + Intergenic
1187067402 X:15854568-15854590 CGGGCCGGGCAGGCTCGGGGTGG + Intronic
1189649881 X:43177553-43177575 AGGGGAGGGGAGGCCAGGTGAGG - Intergenic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190024720 X:46912728-46912750 CGCGGAGGCCGGACCCGGCGCGG + Intronic
1190063321 X:47224347-47224369 GGGGTAGGGCAGGCCAGGTGGGG - Intronic
1190496455 X:51032167-51032189 CAGGGAGTGCAGGCCCTGCCTGG - Intergenic
1190509518 X:51161768-51161790 CAGGGAGTGCAGGCCCTGCCTGG + Intergenic
1192609607 X:72554501-72554523 CGGGGAGGGCGGGGAGGGCGGGG + Intronic
1195843727 X:109203650-109203672 AGGGGATGGCAGGCCAGGGGAGG - Intergenic
1197754434 X:129984102-129984124 CGGGGCGGGCGGGCGGGGCGTGG + Intronic
1198085300 X:133276960-133276982 CGGGGAGGGCTGGGCCGGTGGGG - Intergenic
1198100439 X:133417352-133417374 TGGGGAGGGCGGGGGCGGCGGGG - Intergenic
1200098178 X:153673842-153673864 CGGAGGGGGCGGGGCCGGCGGGG - Intronic
1200117059 X:153774041-153774063 AGGGGCGGGCAGGCCCCTCGCGG - Exonic