ID: 1184406531

View in Genome Browser
Species Human (GRCh38)
Location 22:44303840-44303862
Sequence GAGGGTGGTTCAGCCAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184406531 Original CRISPR GAGGGTGGTTCAGCCAGGCC AGG (reversed) Intronic
900151742 1:1181934-1181956 GTCAGAGGTTCAGCCAGGCCAGG + Intronic
902409151 1:16202589-16202611 GAGGGGAGGTCAGCCTGGCCTGG + Intronic
903787250 1:25869635-25869657 GAGGGAGGTGGAGCCAGGACTGG + Intronic
903912533 1:26738249-26738271 GCGGGTGGATCACCCAGGTCAGG - Intronic
904156663 1:28489328-28489350 GAGAGTGTTCCAGCCAGGCAAGG + Intronic
904927858 1:34062613-34062635 GAGGGTGGGACAGCCAGGCAAGG + Intronic
905435271 1:37951397-37951419 GATGGGGGCACAGCCAGGCCTGG + Intergenic
905446992 1:38034042-38034064 GAGGGTGGGGCACCCAGGCATGG + Intergenic
906764922 1:48420207-48420229 GAGGGTGGCTCATCCAGGGTGGG + Intronic
907507033 1:54926844-54926866 GAGGATGGTTCTGCAAGGACTGG - Intergenic
907919439 1:58899056-58899078 GAGGAAGCTGCAGCCAGGCCTGG + Intergenic
908090615 1:60681727-60681749 GTGTGTGGTGCAGCCAAGCCAGG - Intergenic
908346364 1:63237669-63237691 GAGGGTGGGTCTGCCTGTCCTGG - Intergenic
908597781 1:65707019-65707041 CGGGGTGGCTCAGCCAGGCGTGG - Intergenic
908751004 1:67423083-67423105 GAGGGTGGATCACCGAGGTCAGG + Intronic
910213356 1:84816568-84816590 GTGGGTGGATCACCCAGGTCAGG + Intronic
910914831 1:92277714-92277736 TAGGGTGGTGCATCCAGGCAGGG + Intronic
914999417 1:152574515-152574537 GAAGGTGATTCACCCAGGCTGGG + Intronic
916057294 1:161076554-161076576 GAGGGTGTTTCAGGCAGGGTGGG - Intronic
918367978 1:183829154-183829176 GAAGGTGGATCAGCCAGGCATGG + Intronic
919625762 1:199908715-199908737 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
920282178 1:204852582-204852604 GAGGCTGGTTGACCCATGCCTGG + Intronic
920433359 1:205932917-205932939 GGGGCTCCTTCAGCCAGGCCTGG - Intronic
922801584 1:228367092-228367114 GCGGGTGGCTCAGCGCGGCCAGG - Exonic
923245976 1:232132453-232132475 GAGGGTGGTGCACCCAGGAAGGG + Intergenic
924515120 1:244759696-244759718 GCGGGTGGTTCACTCAGGTCAGG + Intergenic
1062767754 10:78778-78800 GAGGGTGGTGCTGCAAGGTCTGG - Intergenic
1064741742 10:18441174-18441196 GAGGGTAGATCACCCAGGTCAGG + Intronic
1065787522 10:29230082-29230104 GAGGAGGGTTGAGCCAGTCCAGG - Intergenic
1067942741 10:50669925-50669947 CAGGGATGTACAGCCAGGCCTGG - Intergenic
1069884710 10:71616325-71616347 GAGGATGGTGCAGCCCAGCCTGG + Intronic
1070863983 10:79694888-79694910 CAGGGATGTACAGCCAGGCCTGG - Intergenic
1071486290 10:86104672-86104694 GAGGGTGGGGCAGCTGGGCCAGG - Intronic
1071516036 10:86298586-86298608 GAGGGCGTTTCAGCCACCCCAGG - Intronic
1071630882 10:87217114-87217136 CAGGGATGTACAGCCAGGCCTGG - Intergenic
1072541366 10:96400654-96400676 GAGGGAAGTTCAGAAAGGCCAGG - Intronic
1073459876 10:103660403-103660425 GAGGGGGATGCAGCCAGGCCTGG - Intronic
1074304582 10:112264880-112264902 GAGGATGGATCACCGAGGCCAGG + Intergenic
1075892036 10:125960426-125960448 AAGGGTGGTTGAGCCACGCTAGG + Intronic
1076157508 10:128215098-128215120 GAGGCTGGTTCTGCCGGGCTCGG + Intergenic
1076898793 10:133327006-133327028 GAGAGGGGCTCAGCCACGCCAGG + Intronic
1077079618 11:719417-719439 GAGGGGGCCTGAGCCAGGCCTGG + Intronic
1077230637 11:1456862-1456884 GCGGGTGGTCCCGCCAGGCCAGG - Intronic
1077368777 11:2172002-2172024 GAGGATGATTCAGACAGGGCTGG - Intergenic
1078153145 11:8776062-8776084 GAGGGTGGTAGGGCCAGGGCTGG - Intronic
1078572425 11:12470907-12470929 GAAGGTGGTTCTGATAGGCCAGG + Intronic
1079835297 11:25326569-25326591 GAGGGTGGTACACCCAGGGAGGG + Intergenic
1080451151 11:32380026-32380048 GAGGCTTGTTCAGGCGGGCCAGG - Intergenic
1081749482 11:45499592-45499614 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1082065867 11:47899829-47899851 GAGGAAGGTGCAGCCTGGCCAGG - Intergenic
1084021009 11:66418275-66418297 TGGGGTGACTCAGCCAGGCCAGG + Intergenic
1084540057 11:69780835-69780857 GAAGGTGGCCCAGCCAGGTCTGG + Intergenic
1085857884 11:80196442-80196464 GAGGGTGGTGCACCCAGGGATGG + Intergenic
1086327151 11:85713846-85713868 GAAGGGGGTTCAACCAGGACTGG - Intronic
1088071069 11:105785915-105785937 GAGGGTGGATCACTGAGGCCAGG + Intronic
1089223175 11:116892840-116892862 AAGGGTGGTACATCCAGGCAAGG + Intronic
1089435528 11:118462242-118462264 GAGGGTGCTGCAGCCGGGCATGG - Intronic
1089691636 11:120190486-120190508 GAGGGTGGTAAGGCCAGGCAGGG + Intergenic
1090981738 11:131728475-131728497 GAGGGTGGATCACCCAGGGAGGG - Intronic
1091205846 11:133820521-133820543 GAGGATGGATCTTCCAGGCCTGG - Intergenic
1091677124 12:2499622-2499644 GAGGCTGTTTCAGCCAAGGCAGG + Intronic
1091698798 12:2646306-2646328 GAGGTTGGTTCAATTAGGCCAGG + Intronic
1092948115 12:13475542-13475564 GAGGGTGGTGGAGCCAGCCTGGG - Intergenic
1095043716 12:37474594-37474616 GAGGGTGGCTCACCCAGGGATGG - Intergenic
1095955897 12:47805783-47805805 GCCAGTGGTCCAGCCAGGCCAGG + Intronic
1096069219 12:48765566-48765588 GAGAGAGATTCAGCCAGGCCAGG - Intergenic
1097166890 12:57090766-57090788 GAGGGAGGTCCAGCCATCCCAGG + Intronic
1097184732 12:57190472-57190494 GTGGGTGGTGGAGCCAGGGCTGG + Intronic
1098671890 12:73241147-73241169 GAGGGTGGTGGAGCCAGGGGAGG + Intergenic
1099033817 12:77560638-77560660 GAGGGTGTCACAGCCTGGCCTGG - Intergenic
1100269532 12:93011451-93011473 AAGGCCGGTTGAGCCAGGCCAGG + Intergenic
1101573967 12:105980680-105980702 CAGGGTGGTGGCGCCAGGCCTGG - Intergenic
1102133652 12:110553752-110553774 GTGGGTGGATCAGCAAGACCTGG + Intronic
1103409734 12:120702355-120702377 GAGGATCGTTGAGCCAGGCATGG + Intergenic
1104932270 12:132345998-132346020 GCGGGTGCCTCAGCCAAGCCGGG + Intergenic
1105337327 13:19486334-19486356 GATGGTGGTGCAGCCTTGCCAGG + Intronic
1107868805 13:44728698-44728720 GAGGGTGGTGCACCCAGGAAGGG - Intergenic
1108839334 13:54593117-54593139 CAAGTGGGTTCAGCCAGGCCAGG - Intergenic
1112058821 13:95716688-95716710 GAGGGGAGTTCAGCCAGGAGTGG - Intronic
1112802980 13:103132846-103132868 GAGGCAGGTGCAGCCAGGCACGG - Intergenic
1114267087 14:21079106-21079128 GAGGGGCGTTCAACCAAGCCAGG - Intronic
1115640320 14:35331637-35331659 GAGTGTGGCCCAGTCAGGCCTGG + Intergenic
1117400915 14:55358008-55358030 AAGGGTGGGTGGGCCAGGCCTGG - Intronic
1119032041 14:71200381-71200403 GGGGGTGGTGCAACAAGGCCTGG + Intergenic
1119866801 14:77981111-77981133 GAGGCTCCCTCAGCCAGGCCTGG + Intergenic
1120957526 14:90096068-90096090 GAGGGTGGTTCACCCTGGAGAGG - Intronic
1121234741 14:92383901-92383923 GAGTGTGGTCCAGCCAGGCATGG - Intronic
1121595844 14:95161606-95161628 GAGGGTGGTGCACCCAGGGAAGG + Intergenic
1122229513 14:100298702-100298724 GAGGAAGGTTCAACCCGGCCTGG + Intronic
1123998306 15:25733994-25734016 GGGGGGAGTGCAGCCAGGCCTGG + Intronic
1124011736 15:25844671-25844693 CAGGGTGGTCCAGCCAGGAGGGG - Intronic
1124381685 15:29172809-29172831 GGGGGAGGTTCAGCCAGGGCAGG - Intronic
1126312528 15:47334174-47334196 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1127841352 15:62834941-62834963 GAAGGAGGTTCAGCCAGACTTGG + Intronic
1128638434 15:69317977-69317999 GATGGTGGTGCAGTCAGGGCAGG - Intronic
1128682103 15:69659812-69659834 GAGGGTGGACCCCCCAGGCCAGG - Intergenic
1129390340 15:75217128-75217150 CAGGGTGGACCAGCCAGGGCAGG + Intergenic
1129700632 15:77766140-77766162 GTGGCTGGGTCAGCCAGGCATGG + Intronic
1130790946 15:87155738-87155760 GAGGGTGGATCACCGAGGTCAGG + Intergenic
1132291203 15:100705073-100705095 GAGGATGGTGCAGGCTGGCCAGG + Intergenic
1132325354 15:100964231-100964253 GAGGGAGGGTCACCCAGCCCCGG - Intronic
1132684235 16:1155624-1155646 GGGGATGGGGCAGCCAGGCCCGG - Intronic
1133001852 16:2855867-2855889 AGGGGAGGATCAGCCAGGCCTGG + Intronic
1134742462 16:16560060-16560082 GAGGATGGTTCAGTTAGCCCAGG + Intergenic
1134925101 16:18152399-18152421 GAGGATGGTTCAGTTAGCCCAGG - Intergenic
1135082988 16:19452293-19452315 GAGGGTGGCTCACCCAGGGAGGG - Intronic
1135871509 16:26155629-26155651 GCTGTGGGTTCAGCCAGGCCCGG + Intergenic
1136071227 16:27788477-27788499 GAGGGCAGTGGAGCCAGGCCAGG - Exonic
1136187509 16:28596850-28596872 GAGGGGGATTCAGGCCGGCCGGG + Intronic
1136189984 16:28609784-28609806 GAGGGGGATTCACGCAGGCCAGG + Intronic
1136362163 16:29787692-29787714 TAGGGTGGTTTGGCCAGGCGTGG - Intergenic
1136428671 16:30184976-30184998 GAGGGTGGCTCAGAGTGGCCTGG + Intronic
1136617378 16:31406776-31406798 GAGTGGGACTCAGCCAGGCCAGG + Intronic
1138278584 16:55755227-55755249 GAGAGTGCCACAGCCAGGCCTGG + Intergenic
1138289970 16:55838394-55838416 GAGAGTGCCACAGCCAGGCCTGG - Intergenic
1138355152 16:56371762-56371784 CAGGCTGATTCAGCCAGCCCTGG + Intronic
1139366919 16:66439196-66439218 GAGGGTGGTGGAGCTCGGCCTGG + Intronic
1139503859 16:67389331-67389353 GAGAGTAGCTCATCCAGGCCGGG - Intergenic
1139571328 16:67814543-67814565 GAGTGTGGCTCAGAGAGGCCAGG + Intronic
1140111909 16:72011997-72012019 AAGGGTGCTGCAGCCTGGCCTGG + Intronic
1140808611 16:78556021-78556043 GATGGAGGTCCAGCCAGGCCCGG + Intronic
1141895635 16:86957151-86957173 GAGGGCAGCTCAGCCAGGCCTGG + Intergenic
1142363877 16:89639663-89639685 GAGAGTGGTTCTGCCAGTGCAGG - Intergenic
1143598737 17:7930597-7930619 TAGGTTGCTTCAGCCAGCCCGGG + Exonic
1144608702 17:16689975-16689997 GAGGGAGGACCAGCCAGCCCAGG + Intergenic
1144904114 17:18625852-18625874 GAGGGAGGACCAGCCAGCCCAGG - Intergenic
1145128477 17:20320890-20320912 GAGGGAGGACCAGCCAGCCCAGG + Intergenic
1145266461 17:21381900-21381922 TGGGCTGCTTCAGCCAGGCCTGG + Intronic
1145776726 17:27534215-27534237 GAGTGTGTTCCAGCCACGCCTGG + Intronic
1146727660 17:35169265-35169287 GCGGGTGGATCAGTTAGGCCAGG - Intronic
1146860113 17:36289925-36289947 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1147090439 17:38094016-38094038 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1147106774 17:38226510-38226532 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
1147573120 17:41583511-41583533 AAGGGTGGTGCACCCAGGACTGG - Intronic
1147945007 17:44075890-44075912 GGGGGTGGCCCAGCCAGTCCAGG - Exonic
1148101765 17:45096638-45096660 GTGGATGGCTCAGCCAGGCAAGG - Intronic
1148422750 17:47562027-47562049 GAGGGTGGTGCACCCAGGGAGGG + Intronic
1148863757 17:50618143-50618165 GAGGGTGGAGGAGCCAGGGCTGG + Intronic
1149665894 17:58364593-58364615 GAGGGTGGCTGTGCTAGGCCGGG - Intronic
1150229423 17:63541975-63541997 GAGGGTGGTTCTGAAGGGCCTGG + Intronic
1150282791 17:63938991-63939013 GAGGGCTGTTCAGGCAGGACTGG + Exonic
1150285150 17:63950087-63950109 GCGGGTGCTCCAGCCGGGCCAGG + Intronic
1151559379 17:74862330-74862352 AAGGGTGGCTATGCCAGGCCTGG + Intergenic
1151675324 17:75594617-75594639 GCCTGTGGGTCAGCCAGGCCAGG - Intergenic
1151955045 17:77375994-77376016 GAGTGTGATTCAGCCCAGCCAGG + Intronic
1152070692 17:78132322-78132344 CAGGGTGGGTCAGGGAGGCCGGG - Intronic
1152131658 17:78480819-78480841 GGGGATGGTTCCTCCAGGCCAGG - Intronic
1152183628 17:78840662-78840684 GCGGGGGGTTCCGCGAGGCCTGG - Exonic
1152478354 17:80533192-80533214 GAGTGAGGTTCAGTCAAGCCTGG - Intergenic
1152680722 17:81666544-81666566 GAGGGTGGTCGAGGGAGGCCGGG - Exonic
1152864931 17:82716820-82716842 GCGGGTGCATCAGCCAGGGCCGG + Exonic
1152960589 18:78112-78134 GAGGGTGGTGCGGCAAGGTCTGG - Intergenic
1153226733 18:2906082-2906104 GCGGGTCCCTCAGCCAGGCCCGG + Intronic
1153549086 18:6242140-6242162 GAGGGTGGTGTTCCCAGGCCTGG - Intronic
1153937046 18:9936869-9936891 CAGTGTGTTTCAGCCAAGCCAGG + Intronic
1155571113 18:27194879-27194901 GAGGGTGGTTGGGACAGGACAGG + Intergenic
1159045618 18:63366815-63366837 GAGGGCGGGTCCGCGAGGCCGGG + Intronic
1160420376 18:78739966-78739988 GAGGGTGCTGCAGACAGGCCTGG - Intergenic
1160662454 19:307374-307396 GAGGCTGGGTCGGCCAGGGCTGG + Exonic
1161123768 19:2544714-2544736 GTGGGTGATTCAGCCCCGCCAGG + Intronic
1161794073 19:6376374-6376396 GATGCTGGCTCAGCCAGGCCCGG - Intronic
1162139710 19:8578427-8578449 GAGGGAGGTTGGGCCAGGCGTGG - Intergenic
1162518850 19:11167018-11167040 GAGGGTGGTTGTGCAGGGCCTGG + Intronic
1162532417 19:11243497-11243519 AAGGGTGGTGCTGACAGGCCTGG - Intronic
1162700570 19:12511974-12511996 GAGGTTTGTTCAGCCAGCCGCGG - Intronic
1162856104 19:13469747-13469769 GGAGGTGGTTCAGCCGGGCGCGG - Intronic
1162916514 19:13877180-13877202 GAGGGAGCTTAAGCCAGGCAGGG + Intronic
1163153241 19:15427119-15427141 AAGGAGGGTGCAGCCAGGCCTGG + Exonic
1163176828 19:15570013-15570035 GGGGGTGGTGCAGCCAGGCTTGG + Intergenic
1163364883 19:16870284-16870306 GAGGGTGCTACACCCAGGACAGG - Intronic
1163689117 19:18729128-18729150 GAAGTTGGTTCAGGCTGGCCGGG + Intronic
1163831540 19:19549485-19549507 CAGGGATGTTCAGCCAGGACAGG - Intergenic
1165309241 19:35020725-35020747 GAGTGAGGTGCAACCAGGCCAGG + Intronic
1165433143 19:35783726-35783748 GAGCGAGGTGCAGCCAGGGCAGG + Intronic
1165435109 19:35791075-35791097 GTAGCTGGTGCAGCCAGGCCTGG - Intergenic
1165492869 19:36135255-36135277 GAGTGGGGTGCAGCCAGGGCAGG + Intergenic
1165508002 19:36246943-36246965 GAGGGTGGTGCAGCCAGAGACGG - Intergenic
1165943146 19:39425195-39425217 CAGGGTGGTTCAACCGGACCTGG - Exonic
1166059432 19:40316409-40316431 GATGGTGGTGCAGCGAGCCCAGG - Intergenic
1166752397 19:45170520-45170542 CAGGGTCCTTCAGCCAGGCCAGG + Intronic
1166916602 19:46199599-46199621 CAGGGTGGCTGAGTCAGGCCTGG - Intergenic
1167302998 19:48690206-48690228 CACGGTGGCTCAGCCAGGCACGG - Intergenic
1167766954 19:51489955-51489977 GGAGGTGGTTCTGCCAGGCCAGG - Intronic
1168102804 19:54149902-54149924 GAGGGTGGTACAGAAAGACCTGG - Intronic
1168489599 19:56797019-56797041 CACGGTGGCTCAGCCAGGCTTGG + Intronic
1168647519 19:58069971-58069993 GAGGCAGGTGCAGCCATGCCTGG - Intronic
926056283 2:9775969-9775991 AGGGCTGGTTCAGCCAGGCCTGG - Intergenic
926188313 2:10708761-10708783 GAGGGAGGTTCAGGCAGCCTGGG + Intergenic
926822760 2:16871289-16871311 GAGTGTGCTTCTGCCAGGCAGGG + Intergenic
927515312 2:23668749-23668771 GTGGGGGCTGCAGCCAGGCCTGG - Intronic
927711959 2:25331799-25331821 GGGGGAGGCTGAGCCAGGCCAGG - Intronic
928217237 2:29371830-29371852 GGAGGAGGTGCAGCCAGGCCTGG - Intronic
928939034 2:36708628-36708650 GGGAGTTGTTCAGCCAGGCTGGG - Intronic
929101674 2:38320951-38320973 GAGGGGGTTTCACCAAGGCCAGG - Intronic
929153433 2:38768844-38768866 GAGGGTGGTGCACCCAGGGAAGG + Intronic
929600416 2:43201000-43201022 AAGAGTGTTTCAGCCAGGCATGG - Intergenic
929814760 2:45221782-45221804 GGGGGTGGTGAAGCCAGGCTTGG + Intergenic
930033515 2:47072109-47072131 GTGGGTGGAACAGCTAGGCCTGG + Intronic
930763112 2:55057692-55057714 AAGAGTAGTTCACCCAGGCCTGG + Intronic
931105622 2:59052091-59052113 GTGGGTGGTTCTGCCAGGTGGGG + Intergenic
931513318 2:63024053-63024075 GTGGGAGGATCAGCCAGGCGCGG + Intronic
934050506 2:88206556-88206578 GAGGGTGGTGCACCCAGGTAGGG + Intergenic
935022231 2:99242738-99242760 GAGTCTAGTTCTGCCAGGCCTGG - Intronic
935985319 2:108666902-108666924 GAGGGTGGTGCAGCCAGAGAAGG - Intronic
936137750 2:109910557-109910579 GAGGGTGGTGCAGCCAGAGAAGG - Intergenic
936206947 2:110460928-110460950 GAGGGTGGTGCAGCCAGAGAAGG + Intronic
936381715 2:111992360-111992382 GAGGGTGGTGCACCCAGGGCGGG + Intronic
938081829 2:128374271-128374293 GAGGGAGGTGCAGGCAGGGCAGG + Intergenic
943541268 2:189217721-189217743 ACGGGTGGTCCAGACAGGCCTGG + Intergenic
944860513 2:203811640-203811662 GAGGGTGGGGCAGTGAGGCCTGG + Intergenic
946959876 2:224973358-224973380 GAGCGTGGATCAGCCAGGTGGGG + Intronic
948029907 2:234809073-234809095 GTGAGTGGATAAGCCAGGCCAGG + Intergenic
948467670 2:238159963-238159985 GACAGGGGTGCAGCCAGGCCTGG + Intronic
948471148 2:238180569-238180591 GAGAGTGGGGCAGCCAGCCCTGG + Intronic
948617808 2:239212707-239212729 GAGGCTGTGTGAGCCAGGCCTGG + Intronic
948727331 2:239943057-239943079 GAGAGTGGTGCATCCAGTCCTGG + Intronic
948990232 2:241550380-241550402 GAGTGGGCTTCAGCCAGGCCAGG - Intergenic
949056546 2:241931128-241931150 GAGTGTGGTGCAGCAAGGCCTGG - Intergenic
1168886616 20:1264125-1264147 GAGGATGGGACAGCCAGGCATGG + Intronic
1169441152 20:5634971-5634993 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
1170847875 20:19977192-19977214 GAGGGGGGTGCAGCCAGGCAGGG + Intronic
1171904753 20:30892144-30892166 GAGGGTGCTTGGGCCAGGCTAGG - Intergenic
1172155506 20:32820845-32820867 GAGGGAGGTTATGCTAGGCCGGG + Intronic
1175228935 20:57461321-57461343 GAGGCTGGAGGAGCCAGGCCTGG + Intergenic
1176214732 20:63942640-63942662 GAGGGAGGGTCAGGCAGGGCTGG - Intronic
1176285797 21:5018871-5018893 GAGGGTGGTTCAGCTGAGCATGG - Intergenic
1176305516 21:5121126-5121148 GAGGGTGACCCAGCAAGGCCGGG - Intronic
1176736239 21:10549041-10549063 GATGGTGGTGCAGCCTTGCCAGG - Intronic
1178390358 21:32192763-32192785 GAGGGTTATTCAGCCACGCTTGG - Intergenic
1179714105 21:43278988-43279010 AATGGTGTCTCAGCCAGGCCTGG - Intergenic
1179851540 21:44140905-44140927 GAGGGTGACCCAGCAAGGCCGGG + Intronic
1179871384 21:44244604-44244626 GAGGGTGGTTCAGCTGAGCATGG + Intergenic
1180051154 21:45331619-45331641 GAGGGTGGCCCAGGGAGGCCAGG + Intergenic
1180203870 21:46244852-46244874 CAGCCTGCTTCAGCCAGGCCAGG + Exonic
1182052828 22:27326063-27326085 GTGGGTGGTACACCCAGGCGAGG + Intergenic
1183163656 22:36131735-36131757 GAGGGTGCAGCAGCCAGGACTGG - Intergenic
1183175679 22:36223237-36223259 GAGGGTGGCTCATCCAGCCCTGG - Intergenic
1183532905 22:38373813-38373835 GATGGTGGTGCAGCCTTGCCAGG + Intronic
1183695766 22:39421267-39421289 GAGGGTCCGTCAGCCAGGGCTGG - Intronic
1183701804 22:39455171-39455193 GAGGGTTGAACAGCCAGGCTGGG + Intergenic
1184115368 22:42418855-42418877 GAGGGGCCTTCAGCCAGGCCAGG - Intronic
1184123451 22:42469720-42469742 GAAGAAGATTCAGCCAGGCCTGG + Intergenic
1184406531 22:44303840-44303862 GAGGGTGGTTCAGCCAGGCCAGG - Intronic
1184968619 22:47999158-47999180 CAGGGTGATTCAGCCAAGCTTGG - Intergenic
1185098196 22:48822856-48822878 ACGGGTGTTTCAGCCAGGACAGG + Intronic
1185142845 22:49112922-49112944 GAGGGGGCTTGAGCCAGGGCAGG + Intergenic
1185193170 22:49451710-49451732 GAGTGTGGTTCAGGCAGGGCAGG - Intronic
1185199138 22:49491333-49491355 GAGGATGGTGAGGCCAGGCCTGG - Intronic
1185255562 22:49828788-49828810 GTGGGTGGTGCAGCCGGGCTGGG + Intergenic
949312225 3:2712898-2712920 GAGGGTGGCTCACCCAAGCAGGG + Intronic
949400970 3:3665077-3665099 GGTGGTGGTTAAGCCAGGCAAGG - Intergenic
951057697 3:18166719-18166741 CATGGTGGTTCAGCCAAGTCAGG - Intronic
952250498 3:31648580-31648602 GGGGGAGGTGAAGCCAGGCCAGG - Intergenic
952496897 3:33924143-33924165 GAATGTGGTTCAACCTGGCCGGG - Intergenic
953923035 3:46965415-46965437 GAGGGTGCTTCAGCCACCACAGG + Intronic
954145232 3:48631174-48631196 GAGGGTTGGGCAGCCAGGACAGG - Intronic
954369783 3:50164097-50164119 CAGCCTGGGTCAGCCAGGCCAGG + Intronic
954800416 3:53183858-53183880 GAGGGTGCTGAAGCCAGGCCTGG + Intronic
954939254 3:54356005-54356027 GTGGTTGGTCCAGCCAGTCCTGG - Intronic
960997503 3:123349720-123349742 GAGGGTGCTTCAGCAAGGAGAGG - Intronic
961811838 3:129526653-129526675 GATGGGGGCTCAGCCCGGCCAGG + Intergenic
961861547 3:129920549-129920571 TAGTGTGTTTCAGCCAGGCGTGG + Intergenic
963597151 3:147342642-147342664 CAGGGTGGTTGAGAAAGGCCTGG + Intergenic
965773014 3:172200605-172200627 GAGTGTGTTTAAGCCAGGCTAGG + Intronic
966694610 3:182777403-182777425 GAGGGTGGTAGAGCCAGGCTGGG + Intergenic
966863078 3:184241423-184241445 GAGGGTGGTGCCGCCGGGGCCGG + Intronic
967175116 3:186855680-186855702 GCGGGTGGATCACCTAGGCCAGG - Exonic
968424724 4:515437-515459 GAGGCAGGTTCAGCTGGGCCGGG - Intronic
968479896 4:828668-828690 CAGGGTGTGTGAGCCAGGCCAGG + Intergenic
969307983 4:6336517-6336539 GAGGGGGTTGCAGCCAGGCCTGG + Intronic
969532737 4:7738892-7738914 GGGGGTGGGGCAGACAGGCCTGG - Intronic
970234041 4:13940432-13940454 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
971340770 4:25766696-25766718 GAGGGTGGAGCTGCCAGGCAGGG + Intronic
971344318 4:25798051-25798073 GAGGTGGGAACAGCCAGGCCTGG + Intronic
971367387 4:25988318-25988340 GAAGGCGGTTCAGCCCGGACAGG - Intergenic
971390005 4:26176799-26176821 GAAGGTGGTCCAGCCAAGACAGG - Intronic
971519569 4:27531924-27531946 AAGGGTGGTTCGGCCAGGCACGG + Intergenic
974109716 4:57511803-57511825 TTGGGTGGTTCTTCCAGGCCTGG - Intergenic
974444721 4:61965089-61965111 GAGGGAGGGTCACCCAAGCCTGG - Intronic
975527332 4:75364831-75364853 GAGGGAGGTGCAGCCAGGGCAGG - Intergenic
976265760 4:83185665-83185687 GTGGGGGGGTCAGCCCGGCCTGG - Intergenic
977693803 4:99946317-99946339 GGGGCTGGCTCAGACAGGCCGGG + Intronic
978847008 4:113285602-113285624 GAGGGTGGTGCACCCAGGAAGGG - Intronic
980964677 4:139509597-139509619 GTGGGTTGTGCAGCCAGGTCAGG - Exonic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
982091486 4:151883602-151883624 AGGGGTGGGTCAGCCAGGCCTGG + Intergenic
982208238 4:153013578-153013600 GAGGGTGGTTCTACCAGAGCTGG + Intergenic
982376103 4:154692605-154692627 GATGGAGGTTCAGCCAGGCTGGG + Intronic
984715131 4:182917694-182917716 GACGGTCGTGCAGTCAGGCCCGG - Intronic
984838690 4:184048272-184048294 GAGTAAGGTTCAGCCAGGCATGG + Intergenic
985009995 4:185572530-185572552 AAGGGTGATTCGGCCAGGCGCGG - Intergenic
988400295 5:30752985-30753007 GAGGGTGGTGCACCCAGGGAGGG - Intergenic
995379613 5:111517643-111517665 GAGGGTGGTGCACCCAGGGATGG + Intergenic
998037954 5:138932524-138932546 GGGGGTGCTTGGGCCAGGCCAGG + Intronic
999791536 5:154944382-154944404 AAGGGTGGTACAGACAGGCTTGG - Intronic
1000885904 5:166746897-166746919 GGGGGTGGATCACCGAGGCCAGG + Intergenic
1002188536 5:177467217-177467239 AGGGGTGGCTCAGCCAGGCCGGG + Intronic
1002875346 6:1204767-1204789 GAGTGAGGGTCAGCCAGGCTGGG + Intergenic
1003229639 6:4240480-4240502 GAGGGTGCTTAATCAAGGCCGGG + Intergenic
1003936126 6:10976917-10976939 GAGGTTGGTTCACGCAGGCCTGG - Intronic
1004046055 6:12024771-12024793 GTGGTTGGTTAAGCCACGCCAGG + Intronic
1005873487 6:29994621-29994643 GAGGGAGCATCAGCCAGGGCAGG + Intergenic
1006037155 6:31222882-31222904 GAGGGAGCATCAGCCAGGGCAGG - Intergenic
1006075496 6:31529706-31529728 GAGGGAGCATCAGCCAGGGCAGG - Intronic
1007079494 6:39088904-39088926 GAGGGTGGTTGAGCTGGGCCAGG + Intergenic
1007410578 6:41658962-41658984 TAGGGGGGCCCAGCCAGGCCAGG + Intergenic
1007674870 6:43585221-43585243 GAGGGTGGCTCACCCAGGGAGGG - Intronic
1007727238 6:43923917-43923939 GAGTGTGGACAAGCCAGGCCTGG - Intergenic
1009374241 6:62947723-62947745 GAGGGTGGTGCACCCAGGGAGGG + Intergenic
1010155661 6:72789310-72789332 GAGGGTGGATTAGCCAGGTGTGG - Intronic
1013531478 6:111023187-111023209 GATGGTGGAGCAGCCAGGCGTGG - Intronic
1014881062 6:126725305-126725327 GGGGTTGGTTCATTCAGGCCTGG - Intergenic
1018865538 6:167744575-167744597 GAGGGTGGTTTAGGGAGCCCAGG - Intergenic
1018914713 6:168125940-168125962 GTGGGTGGCAGAGCCAGGCCAGG + Intergenic
1019001065 6:168752555-168752577 GAGGGTGGTGCACCCAGGGAAGG - Intergenic
1019016702 6:168885351-168885373 GAGGGAGGCTCACCCAGCCCGGG + Intergenic
1019142267 6:169956333-169956355 GGGCGTGGCTCAGCAAGGCCTGG - Intergenic
1019153532 6:170024112-170024134 GAGTGGGGTTCAGCCGGGCTGGG - Intergenic
1019406393 7:886286-886308 GAGAGTGGAGCAGCCAAGCCAGG - Intronic
1019511364 7:1419265-1419287 GACTGTGTTTCAGCCAGGCTGGG - Intergenic
1019724305 7:2592683-2592705 GAGGGTGCTGCAGGCAGGCGCGG - Intronic
1019896099 7:3984627-3984649 GAGGGTTGTACAGCCAGCTCAGG - Intronic
1021206387 7:17786509-17786531 GAGGGAGCATCAGCCAGGGCAGG - Intergenic
1026834531 7:73629328-73629350 AAGGGTGGTGCGGCCAGGCACGG - Intergenic
1027159379 7:75791312-75791334 GAGGGAGTTTCAGCCAGGCGTGG - Intergenic
1027564640 7:79776423-79776445 GAGGGTGGCACAGCCAGGGAGGG - Intergenic
1029502817 7:100944191-100944213 GGGGGTGGTTTGGCCAGCCCAGG + Intergenic
1029551136 7:101237668-101237690 GAGGGTTGTCCAGGCAGGCTGGG + Exonic
1029739104 7:102482051-102482073 GAGGTTGGCTGAGCCAGGTCTGG + Intergenic
1029757105 7:102581230-102581252 GAGGTTGGCTGAGCCAGGTCTGG + Exonic
1029775046 7:102680291-102680313 GAGGTTGGCTGAGCCAGGTCTGG + Intergenic
1031083489 7:117280170-117280192 GAGGGTGGGTCAGCCAGGGATGG + Intronic
1032223130 7:130009195-130009217 GAGGGTGGCCTTGCCAGGCCCGG + Intergenic
1033682323 7:143606821-143606843 GTGGGTGGATCACCTAGGCCAGG - Intergenic
1033702566 7:143855092-143855114 GTGGGTGGATCACCTAGGCCAGG + Intronic
1037116837 8:15237387-15237409 GAGGGTGGTTCTCCCGAGCCAGG - Intronic
1037535110 8:19816970-19816992 GAAGGTGTTTCAGGCCGGCCCGG + Intergenic
1037697569 8:21238783-21238805 GATGGTGGCTGAGCCAGGACAGG + Intergenic
1037994950 8:23345313-23345335 GAGGGTGACTCACCCAGGGCAGG + Intronic
1039512744 8:38105015-38105037 GAGGGTGGAAAACCCAGGCCGGG - Intergenic
1040110049 8:43563221-43563243 GAGGGACGTTGAGACAGGCCTGG - Intergenic
1040111807 8:43570081-43570103 GGGGGAGGTTGAGGCAGGCCGGG - Intergenic
1040111931 8:43570514-43570536 CAGGGAGGTTGAGGCAGGCCTGG - Intergenic
1040833321 8:51703627-51703649 TAGGGTGGCTCAGCGAGGCTGGG - Intronic
1041238915 8:55832099-55832121 GAGGGGTGCTCAGCCAGCCCTGG + Intergenic
1042089093 8:65139337-65139359 GAGGGTCGATCACCCAGGTCAGG + Intergenic
1044994587 8:97827395-97827417 GAGGGTGGTACACCCAGGAAGGG + Intronic
1045294572 8:100862133-100862155 GAGGCTGGCTCAGCCAGGCTGGG + Intergenic
1045315549 8:101040764-101040786 AAGGGTAGTTCAGCTAGGCAAGG + Intergenic
1045594304 8:103635395-103635417 CTGGGTGGGTCATCCAGGCCTGG - Intronic
1047310726 8:123689505-123689527 GAGGGTGGGTCTGCAAGGGCTGG + Intronic
1049191380 8:141289723-141289745 GAGGGGGGCTCAGGGAGGCCTGG + Intronic
1049661865 8:143823155-143823177 GAGGGTGATTAGGACAGGCCTGG - Intronic
1049694841 8:143978095-143978117 GAGGGTGTTTAATCCTGGCCCGG - Intronic
1049772339 8:144389274-144389296 GAGGGTGGGTCTCCAAGGCCTGG - Intronic
1051751068 9:20341332-20341354 GAGTGTGCTTCAGCAGGGCCTGG + Intergenic
1051822089 9:21180626-21180648 CTGGGTGGGTCTGCCAGGCCTGG + Intergenic
1051823318 9:21192688-21192710 CTGGGTGGGTCTGCCAGGCCTGG + Intergenic
1056338510 9:85601365-85601387 GATGGTGGGGGAGCCAGGCCAGG - Intronic
1056947653 9:91013514-91013536 GAGGGTGGCACAGCCTGGCAGGG + Intergenic
1056948714 9:91024682-91024704 GAGGGTGGGGCATCCAGGCAGGG + Intergenic
1057251577 9:93507625-93507647 AAGAGTGGCTCAGCGAGGCCAGG + Intronic
1058909923 9:109511616-109511638 GAGAGGGGCCCAGCCAGGCCAGG + Intergenic
1059430710 9:114248614-114248636 GAGGCTGGTCCAGAGAGGCCAGG - Intronic
1060207986 9:121693745-121693767 GAGGGTGATGAAGACAGGCCTGG + Intronic
1060294196 9:122332250-122332272 GAGGGAGGGTGAGCCAGGCCTGG + Intergenic
1060444033 9:123670954-123670976 GAGGGTGATACAGGCAGGCTGGG + Intronic
1060482075 9:124022581-124022603 GAGGGTGGGTCAGACTGGCCTGG - Intronic
1060587659 9:124796438-124796460 GAGGGTATATCAGCTAGGCCTGG + Intronic
1060891103 9:127189052-127189074 GAGGGCTGAACAGCCAGGCCAGG + Intronic
1061299912 9:129698329-129698351 GGCGGTGGTGCTGCCAGGCCGGG + Intronic
1061367872 9:130181944-130181966 GAGGGAGGCACAGACAGGCCGGG + Intronic
1061405750 9:130392202-130392224 GTGGGTGTTGCAGCCAGTCCTGG - Intronic
1061545370 9:131301400-131301422 GGGGGTGGTTCATGCAGACCAGG - Intronic
1061852285 9:133423345-133423367 CTGGGTGTTCCAGCCAGGCCAGG + Intronic
1061951754 9:133940140-133940162 GTGAGTGGTTATGCCAGGCCTGG + Intronic
1062053660 9:134459723-134459745 GAGGGAGGCCCAGCCAGGACAGG - Intergenic
1062230098 9:135477382-135477404 GAGGGTGGATCACTCAAGCCAGG + Intergenic
1062322039 9:135994758-135994780 GTGGGGGGCTCAGCCGGGCCGGG - Intergenic
1062542166 9:137046297-137046319 GAGAGAGGTCCAGCGAGGCCCGG - Intergenic
1062573131 9:137194624-137194646 GAGCCTGGTACAGCCTGGCCAGG + Intronic
1062737505 9:138145593-138145615 GAGGGTGGTGCGGCAAGGTCTGG + Intergenic
1186276824 X:7948467-7948489 GAGGAAGGTTCAGCCAGCCCAGG + Intergenic
1187975749 X:24703301-24703323 GAAGCTGGTTCAGGCACGCCAGG + Exonic
1191104917 X:56766839-56766861 GAGGGTGGCTCAGAGAGGCTGGG - Intergenic
1191254659 X:58274550-58274572 GAGGGAGGTTGAGGCAGGGCAGG - Intergenic
1191254769 X:58274944-58274966 AAGGGAGGTTGAGGCAGGCCTGG - Intergenic
1191254917 X:58275528-58275550 GGGGGAGGTTGAGGCAGGCCTGG - Intergenic
1191255098 X:58276294-58276316 GGGGGAGGTTGAGGCAGGCCTGG - Intergenic
1191255396 X:58277483-58277505 GTGGGAGGTTGAGGCAGGCCTGG - Intergenic
1191255699 X:58278677-58278699 GAGGGAGGTTGAGGCAGGCCTGG - Intergenic
1191256250 X:58280868-58280890 GGGTGTGGTTGAGGCAGGCCTGG - Intergenic
1191256635 X:58282351-58282373 GGGGGAGGTTTAGACAGGCCTGG - Intergenic
1191257293 X:58285155-58285177 AAGGGAGGTTGAGGCAGGCCTGG - Intergenic
1193222975 X:78948606-78948628 GAGGGTGGGTGAGACAGGCTAGG - Intronic
1195053528 X:101121102-101121124 GCGGGTGGATCACCGAGGCCAGG - Intronic
1195536566 X:106014379-106014401 GAGGGTAAGTCAGCCTGGCCTGG - Intergenic
1196243471 X:113370389-113370411 GAGGGGAGTTCAGGCAGGACTGG - Intergenic
1198583724 X:138096330-138096352 AGGGGTGGTGAAGCCAGGCCAGG - Intergenic
1199975534 X:152893101-152893123 GCCAGTGGTTTAGCCAGGCCAGG + Intergenic
1200924063 Y:8638738-8638760 GAGGGTGGCTGAGACAAGCCTGG + Intergenic
1201446842 Y:14065950-14065972 GAGGAATGTTCAGCCAGCCCAGG - Intergenic
1202594533 Y:26522204-26522226 GATGGTGGTGCAGCCTTGCCAGG - Intergenic