ID: 1184408390

View in Genome Browser
Species Human (GRCh38)
Location 22:44313019-44313041
Sequence GCCTAGGGCCGCCACCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184408381_1184408390 3 Left 1184408381 22:44312993-44313015 CCTGCAGGAGTCCAGCTCCCGCC 0: 1
1: 1
2: 0
3: 12
4: 231
Right 1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 250
1184408385_1184408390 -8 Left 1184408385 22:44313004-44313026 CCAGCTCCCGCCTGGGCCTAGGG 0: 1
1: 0
2: 1
3: 41
4: 307
Right 1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 250
1184408380_1184408390 4 Left 1184408380 22:44312992-44313014 CCCTGCAGGAGTCCAGCTCCCGC 0: 1
1: 0
2: 0
3: 23
4: 183
Right 1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG 0: 1
1: 0
2: 2
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184408390 Original CRISPR GCCTAGGGCCGCCACCTCCC AGG Intergenic
901235722 1:7666657-7666679 GCCGTGGGCAGCCACCTCCCAGG - Intronic
903067615 1:20709561-20709583 GCCAAGGCACGCCACCTCTCGGG - Intronic
903070953 1:20726815-20726837 ACCAGGGGCCGCCTCCTCCCAGG - Intronic
903524136 1:23980109-23980131 GCCCAGTGCCGCCACCACCAGGG + Intronic
903655569 1:24947164-24947186 GCCTAGGGCCCACAGCTCTCTGG - Intronic
906380143 1:45327423-45327445 GCCCAGCGCTGCCAGCTCCCGGG - Exonic
907515009 1:54988323-54988345 GCCAAGGGGCCCCACCTGCCAGG - Intronic
908174148 1:61537846-61537868 GCCTAGGGCTGCACCCTCTCAGG - Intergenic
910565931 1:88642993-88643015 GACTACAGCCTCCACCTCCCAGG + Intergenic
914242292 1:145859842-145859864 GGCTGGGGCCGCCCCCTCCAGGG + Intergenic
914813692 1:151047900-151047922 GCCTTGGGCCCCCGCCGCCCGGG - Exonic
915257523 1:154645879-154645901 TCCGGGGGCCGCCACCTCCTGGG + Intergenic
916495709 1:165344897-165344919 GCCTGGGGCCCCCAGCTCCAGGG - Intronic
916721762 1:167489753-167489775 GCCCAGGGCAGCCCCCTCCTGGG + Intronic
919914970 1:202133655-202133677 CCCCAGGGCCCCCACCTCCACGG - Exonic
920258725 1:204674427-204674449 CCCCAGGGCTGCCAGCTCCCCGG - Intronic
920816728 1:209341308-209341330 GGCTGGGGCCACCACCACCCCGG - Intergenic
922162934 1:223091500-223091522 CCCAAGGGACGCCATCTCCCAGG + Intergenic
923596173 1:235362135-235362157 GCCTACGGTCACCACCTCCTTGG + Intergenic
1062889712 10:1049058-1049080 GCCTGGTGGTGCCACCTCCCTGG + Exonic
1065318066 10:24483876-24483898 GCCTAGAGCCGCCACTCCCCAGG - Intronic
1067549431 10:47223462-47223484 TCCCAGGGCTGCCATCTCCCAGG + Intergenic
1067682521 10:48449925-48449947 TCCAGGGGCCGCCCCCTCCCTGG + Intronic
1068910464 10:62374197-62374219 GCCCAGGGCTGCCACCTCCGCGG - Exonic
1069381029 10:67843371-67843393 GAATAGGGCCCCCACCTTCCCGG + Intergenic
1069634708 10:69918120-69918142 GCTCAGCGCCCCCACCTCCCAGG + Intronic
1070574672 10:77668766-77668788 GCCCAGGGCTGCCAGCTTCCTGG - Intergenic
1073450138 10:103604262-103604284 GCCTCGGGCCTGTACCTCCCAGG - Intronic
1074501046 10:114025186-114025208 ACCCAGGGCAGCCACCTCCATGG + Intergenic
1075043270 10:119125581-119125603 TACTACGGCCTCCACCTCCCAGG + Intronic
1075129540 10:119726225-119726247 CCCGCGGGCCGCCGCCTCCCTGG + Exonic
1075864257 10:125704256-125704278 GCCCAGGGCAGGCACCTCTCTGG - Intergenic
1076639107 10:131901606-131901628 GCCTGGGGCTGCCTCCTGCCCGG + Intronic
1076697241 10:132252865-132252887 GCGTGGGGCCGCCTCCTCCCAGG + Intronic
1076725915 10:132413058-132413080 GCCTGAGGCAGCCACGTCCCTGG + Intronic
1076726093 10:132413971-132413993 GCCTTGGGGCCCCACCTGCCTGG - Intronic
1077601089 11:3575495-3575517 GCCTGGGGAACCCACCTCCCAGG - Intergenic
1078066303 11:8081402-8081424 GCCCCGGGCCGCATCCTCCCGGG - Intronic
1078492343 11:11781186-11781208 GACCAGGGCAGCCACGTCCCAGG - Intergenic
1079320575 11:19448219-19448241 GGCAGGGACCGCCACCTCCCAGG - Intronic
1079320742 11:19449534-19449556 GGCAGGGACCGCCACCTCCCAGG + Intronic
1080878583 11:36298697-36298719 GCCCGGGGCCCCCAACTCCCGGG - Intronic
1081576044 11:44319157-44319179 GCCCAGGGCGGCCGGCTCCCAGG + Intergenic
1082996933 11:59262375-59262397 GCCAAAGGCCCCCACCTCCCAGG + Intergenic
1083197684 11:61098891-61098913 GCCTGGGGCCTCCCCATCCCTGG - Intergenic
1083595198 11:63915715-63915737 ACCCAGGGCCCCCACCTTCCAGG + Intronic
1083753629 11:64777844-64777866 GCCCAGGGGCGCCTCCGCCCGGG + Intronic
1083880867 11:65547657-65547679 ACCCAGGGCCGCCTCCGCCCTGG + Intronic
1084257008 11:67950069-67950091 GCCTGGGGAACCCACCTCCCAGG - Intergenic
1085263700 11:75223999-75224021 GCCTGGGCCCTCCTCCTCCCCGG - Intergenic
1089126401 11:116179552-116179574 CACTAGGGCCACCACCACCCCGG - Intergenic
1089499922 11:118925842-118925864 GCCGCGCGCCGCCGCCTCCCCGG + Intronic
1089619279 11:119713267-119713289 GCCCTGGGCTGTCACCTCCCAGG - Intronic
1090176806 11:124657114-124657136 GCCTAGAGCTGCCACCACCAAGG - Intronic
1091294882 11:134466616-134466638 GCCCAGGGCAGCCCCCTCCATGG - Intergenic
1091397745 12:163966-163988 GCCTAGGCCCTGCTCCTCCCAGG - Intronic
1091473819 12:753067-753089 CCCCGGGGCCGCCACCGCCCGGG + Exonic
1091548204 12:1518619-1518641 TCCTGGTGCCGCCCCCTCCCTGG + Intergenic
1092333469 12:7606857-7606879 GCCTGGGGGCACCACCTTCCAGG - Intergenic
1092427240 12:8384853-8384875 GCCTGGGGAACCCACCTCCCAGG - Intergenic
1096523281 12:52195980-52196002 GCCTAGGTCCTCCCACTCCCAGG - Intergenic
1098255365 12:68610810-68610832 CCCTAGGCCCGCCCCTTCCCGGG + Intergenic
1101131929 12:101698266-101698288 GCCCAGGGCGGACACCGCCCGGG - Intronic
1101910501 12:108857442-108857464 GCCCAGCGCCGCCTCCTCCTCGG - Exonic
1102115626 12:110400972-110400994 GACTACAGCCTCCACCTCCCAGG - Intronic
1104372679 12:128237431-128237453 GCCCATGGAGGCCACCTCCCTGG - Intergenic
1104969311 12:132524020-132524042 GCCCGGGGCCGGCACCTTCCAGG - Intronic
1107542205 13:41401552-41401574 GCCTGGTGACACCACCTCCCTGG + Intergenic
1114267506 14:21081607-21081629 GCCCAGTGCCGGCACCTTCCAGG + Exonic
1114304276 14:21407016-21407038 GCTTAGGGACGCCTCATCCCAGG - Exonic
1114461087 14:22886610-22886632 GCAGAGGGCCGCCACCTGGCCGG + Exonic
1114525526 14:23365322-23365344 GCCTAGGGCGGGCAGCTCCCGGG - Exonic
1120242026 14:81960500-81960522 GCCCATGGCTGCCACATCCCTGG + Intergenic
1120852561 14:89184652-89184674 GCCTAGTGCCTTCACCTTCCTGG + Intronic
1121442703 14:93958780-93958802 GCCCTGGGCTTCCACCTCCCAGG + Intronic
1121745843 14:96290832-96290854 GCATAGGTCCAACACCTCCCAGG + Exonic
1122094638 14:99362119-99362141 GCCTAGAGCTAACACCTCCCTGG + Intergenic
1122582356 14:102778236-102778258 GCCGAGGGCCGGCGACTCCCGGG + Intronic
1122814945 14:104307672-104307694 GCAGAGGGCAGCCCCCTCCCCGG - Intergenic
1124118430 15:26867971-26867993 GCCGAGGGTCTCCAGCTCCCCGG - Intronic
1124707001 15:31974565-31974587 GCCTTGGGCCGCTCCCTCCCCGG - Intergenic
1125596906 15:40893320-40893342 GACTAGGGTCGCCACCGTCCTGG - Intergenic
1126342274 15:47654252-47654274 GCTTAGGTCTGCCAACTCCCTGG + Intronic
1126778697 15:52120125-52120147 GCCTTGGGCAGCCCCCTCCTGGG - Exonic
1127707722 15:61563662-61563684 GCCTATGGCCGCCACACCCAGGG - Intergenic
1128314062 15:66649086-66649108 GCCTCCGGCCTCCGCCTCCCAGG + Intronic
1129702543 15:77776050-77776072 GCCTGTGGCCGCCACCACCACGG + Intronic
1129871597 15:78945017-78945039 GCTCTGGGCCGCCACCTCCGCGG - Exonic
1130402553 15:83571214-83571236 AACATGGGCCGCCACCTCCCTGG - Intronic
1131184892 15:90265783-90265805 GCCTGGGCCCGCCACCCCCCGGG - Exonic
1131783908 15:95890704-95890726 GCCTGGGGCCACCATCTCTCTGG - Intergenic
1132540596 16:507022-507044 GACTACAGCCTCCACCTCCCAGG + Intronic
1132717891 16:1301247-1301269 GCCTCTGCCCGCCCCCTCCCGGG + Intergenic
1132753020 16:1467561-1467583 GCCTCTGACCCCCACCTCCCAGG + Intronic
1132785740 16:1656241-1656263 GCTTAGGGCAGCCCCCTCCCCGG - Exonic
1132954817 16:2585969-2585991 GGCAAGGGAAGCCACCTCCCCGG - Intronic
1133271798 16:4614153-4614175 CCGCAGGTCCGCCACCTCCCCGG + Intronic
1133337303 16:5014587-5014609 CCCTAAGGCCGCCACAGCCCAGG - Intronic
1133371010 16:5245518-5245540 GCCTGGGGAACCCACCTCCCAGG + Intergenic
1134539921 16:15055997-15056019 GCGGGGGGCCGCCGCCTCCCTGG - Exonic
1141009911 16:80387646-80387668 GCCTGGGGCCCCCTCCTCCAAGG + Intergenic
1141431041 16:83970299-83970321 GCCCAGAGCCGGCACCTACCTGG + Intronic
1142148524 16:88502623-88502645 GCCGAGGGTCCCCACCTCGCAGG + Intronic
1142243110 16:88956052-88956074 GCCCAGGGCTGCCAACCCCCAGG + Intronic
1142747565 17:1967520-1967542 TCCAAAGGCCGCCTCCTCCCTGG + Intronic
1143327497 17:6109044-6109066 TCCTTGGCCAGCCACCTCCCTGG - Intronic
1143516451 17:7421499-7421521 GGACAGGGCCTCCACCTCCCGGG - Exonic
1144756186 17:17681839-17681861 GCCTCGCGCCGCCCCCGCCCCGG - Intronic
1146923230 17:36727641-36727663 GCCAACAGCTGCCACCTCCCAGG + Intergenic
1147729074 17:42586076-42586098 GTCTTGGGCCGCTACGTCCCTGG - Exonic
1147884711 17:43676832-43676854 TCCTATTGCTGCCACCTCCCTGG + Intergenic
1147951602 17:44110881-44110903 GCCTCTGGCGGCCCCCTCCCTGG - Intronic
1148095677 17:45051488-45051510 GCCAGGGCCCGCCCCCTCCCCGG + Intronic
1148193628 17:45697854-45697876 TGCTAGGGCTGCCACTTCCCAGG + Intergenic
1151368213 17:73630696-73630718 CCCCAGGCCTGCCACCTCCCCGG - Intronic
1151425837 17:74030570-74030592 GGCTGTGGCTGCCACCTCCCTGG + Intergenic
1151608427 17:75154672-75154694 GCCTAAGCCCGCCCCCTTCCTGG + Exonic
1152286537 17:79416143-79416165 GCCAAGGGCTGCCACCTGCACGG + Intronic
1152691483 17:81720153-81720175 TCCTGGGGCCACGACCTCCCTGG + Exonic
1153947829 18:10032577-10032599 GCCTGCGGGCCCCACCTCCCCGG - Intergenic
1155055341 18:22177203-22177225 GCCTTGGGCGTCCCCCTCCCAGG + Intronic
1157614086 18:48976523-48976545 GCGGAGCGCCGCCGCCTCCCTGG + Intergenic
1160697417 19:491743-491765 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697472 19:491876-491898 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697500 19:491942-491964 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160697555 19:492075-492097 GCCTGGGGCTGTCTCCTCCCAGG - Intronic
1160856559 19:1220526-1220548 GCCCTGGGGCGCCCCCTCCCGGG + Intronic
1161048897 19:2151632-2151654 GCCCCGCCCCGCCACCTCCCCGG + Intronic
1161421758 19:4179770-4179792 CCCCAGGGCCCCCACCTCCACGG - Intronic
1161436916 19:4268942-4268964 GCTTAGGGCTGCAACATCCCTGG + Exonic
1161512176 19:4677912-4677934 GCCTGGGGCCGCCAGCTGCCTGG + Intronic
1161766701 19:6212534-6212556 ACCTAGCGCCGGCTCCTCCCCGG - Intergenic
1161863918 19:6820209-6820231 GCCTCCTGCCTCCACCTCCCAGG - Intronic
1162228190 19:9242320-9242342 GCCCACGGCAACCACCTCCCGGG + Intergenic
1162514111 19:11138069-11138091 CCCTCGAGCCGCCACCTCCCAGG - Intronic
1163692564 19:18745495-18745517 GCCTAGGCCGGCTACATCCCTGG + Intronic
1163765417 19:19160880-19160902 CCCTGGGCCCGCCTCCTCCCCGG + Intronic
1163809409 19:19421253-19421275 GCCTACTGCCCTCACCTCCCTGG - Intronic
1165236923 19:34428799-34428821 GCCGCGGGCCCCCGCCTCCCCGG + Intronic
1165287221 19:34852297-34852319 GCCTCAGGCCTCCACCTCTCAGG + Intergenic
1165287574 19:34854556-34854578 CCCTATAGCCTCCACCTCCCGGG + Intergenic
1165952289 19:39481106-39481128 GCCTAGGGGAGCAACCACCCAGG - Intronic
1168346668 19:55653196-55653218 GGCGACGGCCGCCCCCTCCCAGG - Intergenic
925097768 2:1220849-1220871 GCCCTGGGCCGCCCCCTCCACGG + Intronic
926035165 2:9630678-9630700 GCCGCGGGCCGCGGCCTCCCCGG - Intronic
929581501 2:43084281-43084303 TCCCAGCCCCGCCACCTCCCTGG - Intergenic
929758088 2:44784744-44784766 GCATGGGGCCCCCACCACCCTGG - Intergenic
930089441 2:47521103-47521125 GCCGAGGGCCGCCGCCTCTCGGG - Exonic
931227140 2:60341330-60341352 CCCCAGGGCCGACACCTGCCAGG + Intergenic
931755191 2:65367664-65367686 GCCTAGTGCCTTCTCCTCCCAGG + Intronic
932456028 2:71850598-71850620 GCCTAGGGCCTTCCTCTCCCCGG - Intergenic
937351822 2:121170415-121170437 GACTACAGCCTCCACCTCCCAGG + Intergenic
942083806 2:172426727-172426749 CCCTAGGGCCAACACCTCACTGG + Intergenic
942240972 2:173964252-173964274 GCCTCGGGCGGGCAGCTCCCGGG + Intronic
946131746 2:217611868-217611890 GCCTAGGGCCTGCACTTCCTGGG + Intronic
946141123 2:217691576-217691598 GCCTAGAGCCTTCACTTCCCTGG - Intronic
947919017 2:233853966-233853988 GGCTGGCGCCGCCTCCTCCCGGG - Intronic
948197744 2:236107782-236107804 GCCTGGGGCCTGCACCTGCCGGG + Intronic
948284216 2:236771513-236771535 GCTCAGTGCCTCCACCTCCCGGG + Intergenic
948353274 2:237358106-237358128 GCCTGGGGCATCCTCCTCCCTGG - Intronic
948615213 2:239194031-239194053 GCCAAGGGCCCCCACCACCTGGG + Intronic
948687530 2:239678256-239678278 CCCTCGGGCCGACACCTTCCTGG + Intergenic
948699611 2:239751561-239751583 GCCAACGGCCCCCTCCTCCCTGG - Intergenic
948793110 2:240389225-240389247 GCTCAGAGCCCCCACCTCCCTGG + Intergenic
1168909829 20:1438886-1438908 GCCTAGCTACTCCACCTCCCAGG - Intergenic
1169260637 20:4135799-4135821 GGCTGGGGCCGCCAACTTCCTGG - Intronic
1171284438 20:23925497-23925519 GCCTGGGGCCTCCAGCACCCAGG + Intergenic
1171964983 20:31523124-31523146 CACTACGGCCTCCACCTCCCGGG + Intronic
1172132336 20:32664177-32664199 ACCCAGGGCCCTCACCTCCCAGG - Intergenic
1175941771 20:62540642-62540664 GCCTGGGGCTGCCAGCTCCAGGG + Intergenic
1176129147 20:63488880-63488902 GCCTGGGGGCTGCACCTCCCCGG + Intronic
1179404009 21:41110556-41110578 GCATAGGGTCACCACCTCCCGGG - Intergenic
1179951016 21:44708854-44708876 GCCTGTGGCTGCCACATCCCGGG + Intronic
1181044875 22:20209760-20209782 GGTCAGGGCTGCCACCTCCCTGG - Intergenic
1181052151 22:20243052-20243074 GCATGGGGCTGCCACCTGCCAGG + Exonic
1182472150 22:30555220-30555242 GCGCAGGGCGGCCACCTCGCGGG + Exonic
1182685254 22:32117595-32117617 GACTACAGCCTCCACCTCCCAGG - Intergenic
1183512496 22:38244280-38244302 GCCTGGGGCAGCACCCTCCCAGG + Intronic
1184100696 22:42340510-42340532 TCCTGGTGCTGCCACCTCCCAGG - Intronic
1184408390 22:44313019-44313041 GCCTAGGGCCGCCACCTCCCAGG + Intergenic
1184610285 22:45599029-45599051 GCCTGGGCCCGCCATCTCCATGG - Intronic
1184837256 22:47031381-47031403 GACCAGGGCCTCCACTTCCCAGG - Intronic
1185320695 22:50199013-50199035 GGCCCTGGCCGCCACCTCCCTGG + Exonic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
949849665 3:8410305-8410327 GCCTTGTGCTGCCACCTTCCTGG - Intergenic
950368656 3:12508121-12508143 GCCTACAGCTGCCACCTCCCAGG - Intronic
950450342 3:13061665-13061687 GCCCAGGGCAGCCAGATCCCTGG - Intronic
950750558 3:15124652-15124674 GCCTGGGGACCCCACCTCCCAGG + Intergenic
953020067 3:39107480-39107502 GCCGAGGGCTTCCACCTCCACGG - Exonic
954149310 3:48649347-48649369 GGCTTGGGCCGCTACCTCCAGGG - Intronic
954560975 3:51556347-51556369 CCCTATGGCCTCAACCTCCCTGG + Intronic
957071949 3:75574548-75574570 GCCTGGGGAACCCACCTCCCAGG - Intergenic
958962846 3:100526410-100526432 GCTAAGGGCCACTACCTCCCAGG + Intronic
959748235 3:109802887-109802909 GCATAGGGATGCCAACTCCCTGG + Intergenic
961282196 3:125772539-125772561 GCCTGGGGAACCCACCTCCCAGG + Intergenic
961485471 3:127212865-127212887 TCCTAGGGCTCCCACCTGCCAGG + Intergenic
963253367 3:143121130-143121152 GCCCAGGGCCGCCTCCGGCCGGG + Exonic
965757319 3:172039977-172039999 GGCGGGGGCCGCCCCCTCCCGGG - Intronic
967878193 3:194280988-194281010 GCCCAAGGCAGCCTCCTCCCTGG + Intergenic
968528319 4:1076197-1076219 GCCTAAGGCCCCCACCCTCCTGG - Intronic
969015539 4:4101870-4101892 GCCTGGGGAACCCACCTCCCAGG - Intergenic
969476603 4:7425771-7425793 GCCTGGGGTCCCCACCTCGCTGG + Intronic
969476904 4:7427063-7427085 GCCTTGGGCCACGGCCTCCCAGG + Intronic
969530471 4:7727594-7727616 GCCAAGGGCAGCCTCCTCCAGGG - Intronic
969797613 4:9538034-9538056 GCCTGGGGAACCCACCTCCCAGG + Intergenic
976134912 4:81925265-81925287 GCCTTGTACTGCCACCTCCCAGG - Intronic
982138609 4:152296222-152296244 GCCCAGGGCTGCCAACTTCCTGG - Intergenic
987062737 5:14258046-14258068 GCCTGGGCTTGCCACCTCCCAGG - Intronic
988911688 5:35849952-35849974 GCCAAAGGCTGCCACCTTCCAGG + Intergenic
989056259 5:37368736-37368758 CACTACGGCCTCCACCTCCCAGG - Intronic
990591167 5:57266417-57266439 GCTTATGGCCTCCGCCTCCCAGG - Intergenic
990955989 5:61339328-61339350 GCCTGCAGCCTCCACCTCCCAGG - Intronic
991621339 5:68548579-68548601 CCCTAGGGCCTCCCCTTCCCTGG + Intergenic
992939753 5:81750788-81750810 GCCCAGCGCCCGCACCTCCCGGG + Intronic
995511720 5:112917418-112917440 GACTTGGGCTGCCACCTTCCTGG - Intronic
998411587 5:141915325-141915347 GCCTAGGCCAGTCACGTCCCGGG - Intergenic
999299388 5:150481815-150481837 ACCCACGGCAGCCACCTCCCTGG + Intergenic
1001808507 5:174609263-174609285 GCCTGGTGCCGCGGCCTCCCGGG + Intergenic
1002359719 5:178661030-178661052 GCCCATGGCCACCACCTTCCTGG + Intergenic
1002649788 5:180682663-180682685 GCCAAGGACAGCTACCTCCCTGG - Intergenic
1003054725 6:2807822-2807844 GCCTCGTGCCACCTCCTCCCTGG + Intergenic
1004213261 6:13674597-13674619 GCTGAGGGCAGCCACCACCCAGG + Intronic
1004618940 6:17316437-17316459 CACTACGGCCTCCACCTCCCGGG + Intergenic
1006671389 6:35731809-35731831 GCCCAGGCCCGCCCCTTCCCGGG + Intergenic
1006778685 6:36616971-36616993 GCCTAGGGGGGCCATCTCCAGGG + Intergenic
1007978940 6:46130363-46130385 GCCTCGGCCCGCCACCTCCCTGG - Intronic
1013359649 6:109382333-109382355 GCTTTGGGCCGCCACCTGCCTGG - Exonic
1015720472 6:136235951-136235973 GCCTATGGTCCCCACCTCCTTGG - Intronic
1018812721 6:167309015-167309037 GCCTGGGGCCCCTTCCTCCCTGG - Intronic
1019048913 6:169168429-169168451 GCCTGGCGCCGCCGCCGCCCTGG - Intergenic
1019335437 7:480530-480552 GTCTAGGGCTGGGACCTCCCGGG - Intergenic
1019340972 7:508788-508810 GGCTGGGGCTGGCACCTCCCTGG - Intronic
1019436945 7:1027443-1027465 GCACGGGGCCGCCACCTGCCCGG + Intronic
1019783664 7:2959591-2959613 GCCTGTCGCCACCACCTCCCCGG - Intronic
1023045226 7:36204701-36204723 GCCTGGAGCTGCCACCTTCCTGG + Intronic
1026744930 7:73004371-73004393 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1026968700 7:74455094-74455116 GCCTAGTGACCCTACCTCCCAGG + Intronic
1027059283 7:75073113-75073135 GCCTCGGGCCTCAACCTCTCTGG + Intronic
1027098810 7:75360711-75360733 CCCCAGGGTCACCACCTCCCAGG + Intergenic
1029367803 7:100127607-100127629 GCCACGGGCCGCCTCCTCCAGGG - Exonic
1029399909 7:100337514-100337536 CCCCAGGGTCACCACCTCCCAGG + Intronic
1029716948 7:102333988-102334010 CCCCAGGGTCACCACCTCCCAGG - Intergenic
1030345055 7:108423808-108423830 GGCTAGGGCCCCCACCTCCCAGG + Intronic
1032089459 7:128904012-128904034 GCCCAGGCCCTGCACCTCCCTGG - Intronic
1033654379 7:143362829-143362851 TCCCCGGGCCGCCCCCTCCCCGG - Intergenic
1034678602 7:152910819-152910841 CCCTGGGGTGGCCACCTCCCAGG + Intergenic
1036243506 8:7097785-7097807 GCCTGGGGAGCCCACCTCCCAGG + Intergenic
1036257304 8:7216282-7216304 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036309350 8:7674878-7674900 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036360189 8:8071241-8071263 GCCTGGGGAGCCCACCTCCCAGG + Intergenic
1036829219 8:12009405-12009427 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036890780 8:12595728-12595750 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1036898325 8:12653644-12653666 GCCTGGGGAGCCCACCTCCCAGG - Intergenic
1037820054 8:22131088-22131110 GCCTGGGCCTGCCCCCTCCCGGG + Exonic
1039843434 8:41309312-41309334 GCCGAGGGCCGCCACTGGCCGGG - Exonic
1040077155 8:43247430-43247452 GCCTAGGGCCCCCTCCCACCTGG - Intergenic
1041641534 8:60207829-60207851 GACTGCGGCCTCCACCTCCCAGG + Intronic
1049072203 8:140364947-140364969 GACTAGGGCAGACCCCTCCCTGG + Intronic
1049469782 8:142770158-142770180 GCCTGTGGCCGTCACCTGCCTGG - Intronic
1049537024 8:143187241-143187263 GCCAAGGGACGCACCCTCCCTGG + Intergenic
1049654674 8:143792359-143792381 GCACCGGGGCGCCACCTCCCAGG + Exonic
1057230889 9:93320698-93320720 CCCCGGGGCCGCCACCTCCAGGG - Intronic
1059346522 9:113632630-113632652 TCCTAGGGCCCCCACCTTCCAGG - Intergenic
1061403166 9:130379303-130379325 GCCCCGGGCCTCCTCCTCCCGGG - Intronic
1061560333 9:131398169-131398191 GCCCAGGTCTGCCAGCTCCCAGG - Intronic
1062107950 9:134765926-134765948 GCCTCGGGCCTCCACCTGCAAGG - Intronic
1062652804 9:137586991-137587013 GCCTTGGGCCGCCAGCCCCACGG + Exonic
1185673605 X:1831004-1831026 GCCTGGCCCCTCCACCTCCCAGG - Intergenic
1186493478 X:9993135-9993157 GCTTGTGTCCGCCACCTCCCGGG + Intergenic
1197771037 X:130089431-130089453 CACTGGGGCCCCCACCTCCCAGG - Intronic