ID: 1184415172

View in Genome Browser
Species Human (GRCh38)
Location 22:44348000-44348022
Sequence GGTGGGGGTCAGGATTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184415172_1184415181 -6 Left 1184415172 22:44348000-44348022 CCACTCTAATCCTGACCCCCACC No data
Right 1184415181 22:44348017-44348039 CCCACCAGGGGACTTGAGGATGG No data
1184415172_1184415184 13 Left 1184415172 22:44348000-44348022 CCACTCTAATCCTGACCCCCACC No data
Right 1184415184 22:44348036-44348058 ATGGCAGCCCTTGTTGCCCCAGG No data
1184415172_1184415177 -10 Left 1184415172 22:44348000-44348022 CCACTCTAATCCTGACCCCCACC No data
Right 1184415177 22:44348013-44348035 GACCCCCACCAGGGGACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184415172 Original CRISPR GGTGGGGGTCAGGATTAGAG TGG (reversed) Intergenic
No off target data available for this crispr