ID: 1184415801

View in Genome Browser
Species Human (GRCh38)
Location 22:44351090-44351112
Sequence CGTGCGAGGCTGAGACCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184415801_1184415810 27 Left 1184415801 22:44351090-44351112 CCCAAAGGTCTCAGCCTCGCACG No data
Right 1184415810 22:44351140-44351162 GCTTTCCAGGTTTGTCTTCCTGG No data
1184415801_1184415808 14 Left 1184415801 22:44351090-44351112 CCCAAAGGTCTCAGCCTCGCACG No data
Right 1184415808 22:44351127-44351149 TCCAAACTTGTCAGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184415801 Original CRISPR CGTGCGAGGCTGAGACCTTT GGG (reversed) Intergenic
No off target data available for this crispr