ID: 1184418293

View in Genome Browser
Species Human (GRCh38)
Location 22:44364561-44364583
Sequence CTGCTTAAGGAGAAGGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184418287_1184418293 18 Left 1184418287 22:44364520-44364542 CCTGACTGTAATTGGTACAAGGG No data
Right 1184418293 22:44364561-44364583 CTGCTTAAGGAGAAGGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184418293 Original CRISPR CTGCTTAAGGAGAAGGATGA GGG Intergenic
No off target data available for this crispr