ID: 1184419362

View in Genome Browser
Species Human (GRCh38)
Location 22:44370553-44370575
Sequence CTTCCACACCCGATGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184419362_1184419368 19 Left 1184419362 22:44370553-44370575 CCAGGCCCCATCGGGTGTGGAAG No data
Right 1184419368 22:44370595-44370617 GCATCCAAACCAGATGTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184419362 Original CRISPR CTTCCACACCCGATGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr