ID: 1184420695

View in Genome Browser
Species Human (GRCh38)
Location 22:44381331-44381353
Sequence CCTCCTCAGCTCCTGTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184420695_1184420702 17 Left 1184420695 22:44381331-44381353 CCTGGCAACAGGAGCTGAGGAGG No data
Right 1184420702 22:44381371-44381393 CAGGGAAAGGAGTTCAAATCAGG No data
1184420695_1184420701 4 Left 1184420695 22:44381331-44381353 CCTGGCAACAGGAGCTGAGGAGG No data
Right 1184420701 22:44381358-44381380 AAGCTCGACTCTGCAGGGAAAGG No data
1184420695_1184420700 -1 Left 1184420695 22:44381331-44381353 CCTGGCAACAGGAGCTGAGGAGG No data
Right 1184420700 22:44381353-44381375 GAGGGAAGCTCGACTCTGCAGGG No data
1184420695_1184420699 -2 Left 1184420695 22:44381331-44381353 CCTGGCAACAGGAGCTGAGGAGG No data
Right 1184420699 22:44381352-44381374 GGAGGGAAGCTCGACTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184420695 Original CRISPR CCTCCTCAGCTCCTGTTGCC AGG (reversed) Intergenic
No off target data available for this crispr