ID: 1184433845

View in Genome Browser
Species Human (GRCh38)
Location 22:44458251-44458273
Sequence GGGCCCAGAGGAGGTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184433845_1184433855 4 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433855 22:44458278-44458300 GGACTGGCTCCAAGGCAGGATGG No data
1184433845_1184433856 5 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433856 22:44458279-44458301 GACTGGCTCCAAGGCAGGATGGG No data
1184433845_1184433857 8 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433857 22:44458282-44458304 TGGCTCCAAGGCAGGATGGGAGG No data
1184433845_1184433858 9 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433858 22:44458283-44458305 GGCTCCAAGGCAGGATGGGAGGG No data
1184433845_1184433851 -4 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433851 22:44458270-44458292 GCCCATCTGGACTGGCTCCAAGG No data
1184433845_1184433854 0 Left 1184433845 22:44458251-44458273 CCTGTGCCACCTCCTCTGGGCCC No data
Right 1184433854 22:44458274-44458296 ATCTGGACTGGCTCCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184433845 Original CRISPR GGGCCCAGAGGAGGTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr