ID: 1184437244

View in Genome Browser
Species Human (GRCh38)
Location 22:44486665-44486687
Sequence AGGGCTCTGCTGTGGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184437244_1184437254 8 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437244_1184437258 23 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437258 22:44486711-44486733 AGCTCAGGGCATCAGCAGGCTGG No data
1184437244_1184437255 9 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437255 22:44486697-44486719 AAGCTGAACAGGCCAGCTCAGGG No data
1184437244_1184437252 -2 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437252 22:44486686-44486708 CTCTGGACACCAAGCTGAACAGG No data
1184437244_1184437256 19 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437256 22:44486707-44486729 GGCCAGCTCAGGGCATCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184437244 Original CRISPR AGGGCTCTGCTGTGGGCCCG GGG (reversed) Intergenic
No off target data available for this crispr