ID: 1184437254

View in Genome Browser
Species Human (GRCh38)
Location 22:44486696-44486718
Sequence CAAGCTGAACAGGCCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184437248_1184437254 1 Left 1184437248 22:44486672-44486694 CCCACAGCAGAGCCCTCTGGACA No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437249_1184437254 0 Left 1184437249 22:44486673-44486695 CCACAGCAGAGCCCTCTGGACAC No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437240_1184437254 14 Left 1184437240 22:44486659-44486681 CCCTCCCCCCGGGCCCACAGCAG No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437243_1184437254 9 Left 1184437243 22:44486664-44486686 CCCCCGGGCCCACAGCAGAGCCC No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437244_1184437254 8 Left 1184437244 22:44486665-44486687 CCCCGGGCCCACAGCAGAGCCCT No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437241_1184437254 13 Left 1184437241 22:44486660-44486682 CCTCCCCCCGGGCCCACAGCAGA No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437246_1184437254 6 Left 1184437246 22:44486667-44486689 CCGGGCCCACAGCAGAGCCCTCT No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437245_1184437254 7 Left 1184437245 22:44486666-44486688 CCCGGGCCCACAGCAGAGCCCTC No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data
1184437242_1184437254 10 Left 1184437242 22:44486663-44486685 CCCCCCGGGCCCACAGCAGAGCC No data
Right 1184437254 22:44486696-44486718 CAAGCTGAACAGGCCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184437254 Original CRISPR CAAGCTGAACAGGCCAGCTC AGG Intergenic
No off target data available for this crispr