ID: 1184441994

View in Genome Browser
Species Human (GRCh38)
Location 22:44522758-44522780
Sequence AGCACAGAGGTGGGGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184441994_1184442003 26 Left 1184441994 22:44522758-44522780 CCAAATGTCCCCACCTCTGTGCT No data
Right 1184442003 22:44522807-44522829 TTACTCAGCCTTCCCCCCATGGG No data
1184441994_1184442002 25 Left 1184441994 22:44522758-44522780 CCAAATGTCCCCACCTCTGTGCT No data
Right 1184442002 22:44522806-44522828 CTTACTCAGCCTTCCCCCCATGG No data
1184441994_1184442004 27 Left 1184441994 22:44522758-44522780 CCAAATGTCCCCACCTCTGTGCT No data
Right 1184442004 22:44522808-44522830 TACTCAGCCTTCCCCCCATGGGG No data
1184441994_1184442000 0 Left 1184441994 22:44522758-44522780 CCAAATGTCCCCACCTCTGTGCT No data
Right 1184442000 22:44522781-44522803 TTCAGGCTTTTTCTGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184441994 Original CRISPR AGCACAGAGGTGGGGACATT TGG (reversed) Intergenic
No off target data available for this crispr