ID: 1184442866

View in Genome Browser
Species Human (GRCh38)
Location 22:44529109-44529131
Sequence CAGAGCTACAACTCCAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184442866_1184442869 2 Left 1184442866 22:44529109-44529131 CCTAAATTGGAGTTGTAGCTCTG No data
Right 1184442869 22:44529134-44529156 ACTGGCAAATTGCACAGATGTGG No data
1184442866_1184442870 23 Left 1184442866 22:44529109-44529131 CCTAAATTGGAGTTGTAGCTCTG No data
Right 1184442870 22:44529155-44529177 GGACTAGTGATCACTCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184442866 Original CRISPR CAGAGCTACAACTCCAATTT AGG (reversed) Intergenic
No off target data available for this crispr