ID: 1184444385

View in Genome Browser
Species Human (GRCh38)
Location 22:44538974-44538996
Sequence TGGAAAGGCCAGGATCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184444385_1184444393 23 Left 1184444385 22:44538974-44538996 CCAGGCAGATCCTGGCCTTTCCA No data
Right 1184444393 22:44539020-44539042 CAACCCTGCAGCCTGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184444385 Original CRISPR TGGAAAGGCCAGGATCTGCC TGG (reversed) Intergenic
No off target data available for this crispr