ID: 1184451343

View in Genome Browser
Species Human (GRCh38)
Location 22:44584502-44584524
Sequence GTGGGCTGCCACTTGGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184451343_1184451352 26 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451343_1184451347 2 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451343_1184451351 16 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451343_1184451350 15 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451350 22:44584540-44584562 ACAAAAAAGGAGATGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184451343 Original CRISPR GTGGGCTGCCACTTGGTGCC AGG (reversed) Intergenic
No off target data available for this crispr