ID: 1184451347

View in Genome Browser
Species Human (GRCh38)
Location 22:44584527-44584549
Sequence CTTCACTGACCCGACAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184451338_1184451347 16 Left 1184451338 22:44584488-44584510 CCCCCAGAACAGTGCCTGGCACC No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451339_1184451347 15 Left 1184451339 22:44584489-44584511 CCCCAGAACAGTGCCTGGCACCA No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451341_1184451347 13 Left 1184451341 22:44584491-44584513 CCAGAACAGTGCCTGGCACCAAG No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451336_1184451347 27 Left 1184451336 22:44584477-44584499 CCTCACTCAGGCCCCCAGAACAG No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451343_1184451347 2 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451340_1184451347 14 Left 1184451340 22:44584490-44584512 CCCAGAACAGTGCCTGGCACCAA 0: 3
1: 29
2: 279
3: 1250
4: 3750
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data
1184451344_1184451347 -5 Left 1184451344 22:44584509-44584531 CCAAGTGGCAGCCCACATCTTCA No data
Right 1184451347 22:44584527-44584549 CTTCACTGACCCGACAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184451347 Original CRISPR CTTCACTGACCCGACAAAAA AGG Intergenic
No off target data available for this crispr