ID: 1184451351

View in Genome Browser
Species Human (GRCh38)
Location 22:44584541-44584563
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184451345_1184451351 -2 Left 1184451345 22:44584520-44584542 CCCACATCTTCACTGACCCGACA No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451343_1184451351 16 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451339_1184451351 29 Left 1184451339 22:44584489-44584511 CCCCAGAACAGTGCCTGGCACCA No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451344_1184451351 9 Left 1184451344 22:44584509-44584531 CCAAGTGGCAGCCCACATCTTCA No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451341_1184451351 27 Left 1184451341 22:44584491-44584513 CCAGAACAGTGCCTGGCACCAAG No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451338_1184451351 30 Left 1184451338 22:44584488-44584510 CCCCCAGAACAGTGCCTGGCACC No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451346_1184451351 -3 Left 1184451346 22:44584521-44584543 CCACATCTTCACTGACCCGACAA No data
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data
1184451340_1184451351 28 Left 1184451340 22:44584490-44584512 CCCAGAACAGTGCCTGGCACCAA 0: 3
1: 29
2: 279
3: 1250
4: 3750
Right 1184451351 22:44584541-44584563 CAAAAAAGGAGATGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184451351 Original CRISPR CAAAAAAGGAGATGAGCAGA GGG Intergenic
No off target data available for this crispr