ID: 1184451352

View in Genome Browser
Species Human (GRCh38)
Location 22:44584551-44584573
Sequence GATGAGCAGAGGGTGCCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184451343_1184451352 26 Left 1184451343 22:44584502-44584524 CCTGGCACCAAGTGGCAGCCCAC No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451344_1184451352 19 Left 1184451344 22:44584509-44584531 CCAAGTGGCAGCCCACATCTTCA No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451346_1184451352 7 Left 1184451346 22:44584521-44584543 CCACATCTTCACTGACCCGACAA No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451345_1184451352 8 Left 1184451345 22:44584520-44584542 CCCACATCTTCACTGACCCGACA No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451349_1184451352 -9 Left 1184451349 22:44584537-44584559 CCGACAAAAAAGGAGATGAGCAG No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data
1184451348_1184451352 -8 Left 1184451348 22:44584536-44584558 CCCGACAAAAAAGGAGATGAGCA No data
Right 1184451352 22:44584551-44584573 GATGAGCAGAGGGTGCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184451352 Original CRISPR GATGAGCAGAGGGTGCCTTT TGG Intergenic
No off target data available for this crispr