ID: 1184453540

View in Genome Browser
Species Human (GRCh38)
Location 22:44596818-44596840
Sequence TGCCCACTGCAGGCCCACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184453534_1184453540 17 Left 1184453534 22:44596778-44596800 CCGGCCAGCTTTGGTGGACAATG No data
Right 1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG No data
1184453532_1184453540 19 Left 1184453532 22:44596776-44596798 CCCCGGCCAGCTTTGGTGGACAA No data
Right 1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG No data
1184453529_1184453540 28 Left 1184453529 22:44596767-44596789 CCAGCAGGACCCCGGCCAGCTTT No data
Right 1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG No data
1184453533_1184453540 18 Left 1184453533 22:44596777-44596799 CCCGGCCAGCTTTGGTGGACAAT No data
Right 1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG No data
1184453535_1184453540 13 Left 1184453535 22:44596782-44596804 CCAGCTTTGGTGGACAATGAGCA No data
Right 1184453540 22:44596818-44596840 TGCCCACTGCAGGCCCACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184453540 Original CRISPR TGCCCACTGCAGGCCCACAG CGG Intergenic
No off target data available for this crispr