ID: 1184454416

View in Genome Browser
Species Human (GRCh38)
Location 22:44601010-44601032
Sequence CCCAAGGCAATGGGGGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184454403_1184454416 3 Left 1184454403 22:44600984-44601006 CCCTCCCTGCGTCAGCTCAACCC No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454402_1184454416 7 Left 1184454402 22:44600980-44601002 CCAGCCCTCCCTGCGTCAGCTCA No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454399_1184454416 14 Left 1184454399 22:44600973-44600995 CCCCTGGCCAGCCCTCCCTGCGT No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454400_1184454416 13 Left 1184454400 22:44600974-44600996 CCCTGGCCAGCCCTCCCTGCGTC No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454401_1184454416 12 Left 1184454401 22:44600975-44600997 CCTGGCCAGCCCTCCCTGCGTCA No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454406_1184454416 -2 Left 1184454406 22:44600989-44601011 CCTGCGTCAGCTCAACCCTGACC No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454405_1184454416 -1 Left 1184454405 22:44600988-44601010 CCCTGCGTCAGCTCAACCCTGAC No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data
1184454404_1184454416 2 Left 1184454404 22:44600985-44601007 CCTCCCTGCGTCAGCTCAACCCT No data
Right 1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184454416 Original CRISPR CCCAAGGCAATGGGGGCAAT GGG Intergenic
No off target data available for this crispr