ID: 1184457219

View in Genome Browser
Species Human (GRCh38)
Location 22:44617878-44617900
Sequence ACCACACATGTACACACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184457217_1184457219 24 Left 1184457217 22:44617831-44617853 CCACACTGGACACACACACAACA No data
Right 1184457219 22:44617878-44617900 ACCACACATGTACACACACACGG No data
1184457218_1184457219 -9 Left 1184457218 22:44617864-44617886 CCACACACAGACATACCACACAT No data
Right 1184457219 22:44617878-44617900 ACCACACATGTACACACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184457219 Original CRISPR ACCACACATGTACACACACA CGG Intergenic
No off target data available for this crispr