ID: 1184457722

View in Genome Browser
Species Human (GRCh38)
Location 22:44621004-44621026
Sequence ATGGAAACACACACCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184457712_1184457722 16 Left 1184457712 22:44620965-44620987 CCTCCCCGAGTTACTGTCAGGGC No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457713_1184457722 13 Left 1184457713 22:44620968-44620990 CCCCGAGTTACTGTCAGGGCGCT No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457715_1184457722 11 Left 1184457715 22:44620970-44620992 CCGAGTTACTGTCAGGGCGCTGG No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457707_1184457722 27 Left 1184457707 22:44620954-44620976 CCCACCAGGAGCCTCCCCGAGTT No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457706_1184457722 28 Left 1184457706 22:44620953-44620975 CCCCACCAGGAGCCTCCCCGAGT No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457708_1184457722 26 Left 1184457708 22:44620955-44620977 CCACCAGGAGCCTCCCCGAGTTA No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457714_1184457722 12 Left 1184457714 22:44620969-44620991 CCCGAGTTACTGTCAGGGCGCTG No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data
1184457709_1184457722 23 Left 1184457709 22:44620958-44620980 CCAGGAGCCTCCCCGAGTTACTG No data
Right 1184457722 22:44621004-44621026 ATGGAAACACACACCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184457722 Original CRISPR ATGGAAACACACACCTCCCA CGG Intergenic
No off target data available for this crispr