ID: 1184458169

View in Genome Browser
Species Human (GRCh38)
Location 22:44623075-44623097
Sequence TAGAAAAATGAGAAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184458161_1184458169 27 Left 1184458161 22:44623025-44623047 CCAGGGAATCAGGGCAGGCTTCC No data
Right 1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG No data
1184458167_1184458169 6 Left 1184458167 22:44623046-44623068 CCGGGAGGAGGTCTTTTCTTGGC No data
Right 1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184458169 Original CRISPR TAGAAAAATGAGAAAGAGGC CGG Intergenic
No off target data available for this crispr