ID: 1184458748

View in Genome Browser
Species Human (GRCh38)
Location 22:44625584-44625606
Sequence CACCGCTGGTGGGTGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184458728_1184458748 26 Left 1184458728 22:44625535-44625557 CCCAGGGGGTCCTCTCCACACCC No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458737_1184458748 6 Left 1184458737 22:44625555-44625577 CCCCATCAGGAGGCGGATGGGCA No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458729_1184458748 25 Left 1184458729 22:44625536-44625558 CCAGGGGGTCCTCTCCACACCCC No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458734_1184458748 11 Left 1184458734 22:44625550-44625572 CCACACCCCATCAGGAGGCGGAT No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458738_1184458748 5 Left 1184458738 22:44625556-44625578 CCCATCAGGAGGCGGATGGGCAG No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458727_1184458748 30 Left 1184458727 22:44625531-44625553 CCATCCCAGGGGGTCCTCTCCAC No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458731_1184458748 16 Left 1184458731 22:44625545-44625567 CCTCTCCACACCCCATCAGGAGG No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data
1184458739_1184458748 4 Left 1184458739 22:44625557-44625579 CCATCAGGAGGCGGATGGGCAGG No data
Right 1184458748 22:44625584-44625606 CACCGCTGGTGGGTGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184458748 Original CRISPR CACCGCTGGTGGGTGGGGAC TGG Intergenic
No off target data available for this crispr