ID: 1184459211

View in Genome Browser
Species Human (GRCh38)
Location 22:44627736-44627758
Sequence GCACATGCATGGGCTCTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184459211_1184459224 10 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459224 22:44627769-44627791 CGCGGCCTGTGCTGGGAAGGAGG No data
1184459211_1184459228 19 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459228 22:44627778-44627800 TGCTGGGAAGGAGGGAGAGGAGG No data
1184459211_1184459222 7 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459222 22:44627766-44627788 CACCGCGGCCTGTGCTGGGAAGG No data
1184459211_1184459225 11 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459225 22:44627770-44627792 GCGGCCTGTGCTGGGAAGGAGGG No data
1184459211_1184459227 16 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459227 22:44627775-44627797 CTGTGCTGGGAAGGAGGGAGAGG No data
1184459211_1184459221 3 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459221 22:44627762-44627784 GAGGCACCGCGGCCTGTGCTGGG No data
1184459211_1184459218 -8 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459218 22:44627751-44627773 GCATGTGCCTGGAGGCACCGCGG No data
1184459211_1184459220 2 Left 1184459211 22:44627736-44627758 CCCCGCAGAGCCCATGCATGTGC No data
Right 1184459220 22:44627761-44627783 GGAGGCACCGCGGCCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184459211 Original CRISPR GCACATGCATGGGCTCTGCG GGG (reversed) Intergenic
No off target data available for this crispr