ID: 1184459343

View in Genome Browser
Species Human (GRCh38)
Location 22:44628285-44628307
Sequence TCCCTGTCACCCACCCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184459339_1184459343 -3 Left 1184459339 22:44628265-44628287 CCTGCACCCTGGACTTCCTCTCC No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459340_1184459343 -9 Left 1184459340 22:44628271-44628293 CCCTGGACTTCCTCTCCCTGTCA No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459337_1184459343 5 Left 1184459337 22:44628257-44628279 CCTGCCTGCCTGCACCCTGGACT No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459335_1184459343 14 Left 1184459335 22:44628248-44628270 CCAGGGCAGCCTGCCTGCCTGCA No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459334_1184459343 27 Left 1184459334 22:44628235-44628257 CCAGGGGCTGGGGCCAGGGCAGC No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459333_1184459343 28 Left 1184459333 22:44628234-44628256 CCCAGGGGCTGGGGCCAGGGCAG No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459341_1184459343 -10 Left 1184459341 22:44628272-44628294 CCTGGACTTCCTCTCCCTGTCAC No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data
1184459338_1184459343 1 Left 1184459338 22:44628261-44628283 CCTGCCTGCACCCTGGACTTCCT No data
Right 1184459343 22:44628285-44628307 TCCCTGTCACCCACCCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184459343 Original CRISPR TCCCTGTCACCCACCCATCA AGG Intergenic
No off target data available for this crispr