ID: 1184460159

View in Genome Browser
Species Human (GRCh38)
Location 22:44633330-44633352
Sequence GACCCAGGGGAGCTCACGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184460159_1184460171 20 Left 1184460159 22:44633330-44633352 CCCACCGTGAGCTCCCCTGGGTC No data
Right 1184460171 22:44633373-44633395 CTGTGTCCACAGCACCCAGCAGG No data
1184460159_1184460173 22 Left 1184460159 22:44633330-44633352 CCCACCGTGAGCTCCCCTGGGTC No data
Right 1184460173 22:44633375-44633397 GTGTCCACAGCACCCAGCAGGGG No data
1184460159_1184460172 21 Left 1184460159 22:44633330-44633352 CCCACCGTGAGCTCCCCTGGGTC No data
Right 1184460172 22:44633374-44633396 TGTGTCCACAGCACCCAGCAGGG No data
1184460159_1184460165 -9 Left 1184460159 22:44633330-44633352 CCCACCGTGAGCTCCCCTGGGTC No data
Right 1184460165 22:44633344-44633366 CCCTGGGTCAGAGACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184460159 Original CRISPR GACCCAGGGGAGCTCACGGT GGG (reversed) Intergenic