ID: 1184464947

View in Genome Browser
Species Human (GRCh38)
Location 22:44663478-44663500
Sequence CAATGGGAACAGAGAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184464947_1184464954 26 Left 1184464947 22:44663478-44663500 CCAATCTCTCTCTGTTCCCATTG No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184464947 Original CRISPR CAATGGGAACAGAGAGAGAT TGG (reversed) Intergenic
No off target data available for this crispr