ID: 1184464954

View in Genome Browser
Species Human (GRCh38)
Location 22:44663527-44663549
Sequence CCTCCTGCCCACCTCTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184464949_1184464954 9 Left 1184464949 22:44663495-44663517 CCATTGTCATTTCGCCCTTTTCT No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data
1184464950_1184464954 -5 Left 1184464950 22:44663509-44663531 CCCTTTTCTCACTCTGACCCTCC No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data
1184464947_1184464954 26 Left 1184464947 22:44663478-44663500 CCAATCTCTCTCTGTTCCCATTG No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data
1184464948_1184464954 10 Left 1184464948 22:44663494-44663516 CCCATTGTCATTTCGCCCTTTTC No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data
1184464951_1184464954 -6 Left 1184464951 22:44663510-44663532 CCTTTTCTCACTCTGACCCTCCT No data
Right 1184464954 22:44663527-44663549 CCTCCTGCCCACCTCTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184464954 Original CRISPR CCTCCTGCCCACCTCTTATA AGG Intergenic
No off target data available for this crispr