ID: 1184465280

View in Genome Browser
Species Human (GRCh38)
Location 22:44665356-44665378
Sequence TGACCCATGGAGGCAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465280_1184465292 23 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465292 22:44665402-44665424 GTCCACCCAGGTCAGCCTCAGGG No data
1184465280_1184465284 -8 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465284 22:44665371-44665393 ATGGGTCAAATGTAACCAGGTGG No data
1184465280_1184465291 22 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG No data
1184465280_1184465287 -5 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465287 22:44665374-44665396 GGTCAAATGTAACCAGGTGGGGG No data
1184465280_1184465285 -7 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465285 22:44665372-44665394 TGGGTCAAATGTAACCAGGTGGG No data
1184465280_1184465286 -6 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465286 22:44665373-44665395 GGGTCAAATGTAACCAGGTGGGG No data
1184465280_1184465289 11 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465280 Original CRISPR TGACCCATGGAGGCAGTTGC TGG (reversed) Intergenic
No off target data available for this crispr