ID: 1184465281

View in Genome Browser
Species Human (GRCh38)
Location 22:44665366-44665388
Sequence TGGTTACATTTGACCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465281_1184465291 12 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG No data
1184465281_1184465296 26 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data
1184465281_1184465292 13 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465292 22:44665402-44665424 GTCCACCCAGGTCAGCCTCAGGG No data
1184465281_1184465289 1 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465281 Original CRISPR TGGTTACATTTGACCCATGG AGG (reversed) Intergenic
No off target data available for this crispr