ID: 1184465288

View in Genome Browser
Species Human (GRCh38)
Location 22:44665386-44665408
Sequence GGTGGACGGCATCCCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465288_1184465292 -7 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465292 22:44665402-44665424 GTCCACCCAGGTCAGCCTCAGGG No data
1184465288_1184465301 24 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465288_1184465299 22 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465299 22:44665431-44665453 AAGTAGGCAGTGAATGGATCTGG No data
1184465288_1184465298 16 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465298 22:44665425-44665447 AGCACAAAGTAGGCAGTGAATGG No data
1184465288_1184465296 6 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data
1184465288_1184465291 -8 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465291 22:44665401-44665423 CGTCCACCCAGGTCAGCCTCAGG No data
1184465288_1184465302 30 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465302 22:44665439-44665461 AGTGAATGGATCTGGGGAGCAGG No data
1184465288_1184465300 23 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465300 22:44665432-44665454 AGTAGGCAGTGAATGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465288 Original CRISPR GGTGGACGGCATCCCCCACC TGG (reversed) Intergenic