ID: 1184465289

View in Genome Browser
Species Human (GRCh38)
Location 22:44665390-44665412
Sequence GTGGGGGATGCCGTCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465280_1184465289 11 Left 1184465280 22:44665356-44665378 CCAGCAACTGCCTCCATGGGTCA No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data
1184465277_1184465289 22 Left 1184465277 22:44665345-44665367 CCGGCTGATCTCCAGCAACTGCC No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data
1184465281_1184465289 1 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data
1184465283_1184465289 -2 Left 1184465283 22:44665369-44665391 CCATGGGTCAAATGTAACCAGGT No data
Right 1184465289 22:44665390-44665412 GTGGGGGATGCCGTCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465289 Original CRISPR GTGGGGGATGCCGTCCACCC AGG Intergenic
No off target data available for this crispr