ID: 1184465294

View in Genome Browser
Species Human (GRCh38)
Location 22:44665407-44665429
Sequence GTGCTCCCTGAGGCTGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465294_1184465305 12 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465305 22:44665442-44665464 GAATGGATCTGGGGAGCAGGGGG No data
1184465294_1184465306 29 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465306 22:44665459-44665481 AGGGGGCGCCACAAATGACGTGG No data
1184465294_1184465299 1 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465299 22:44665431-44665453 AAGTAGGCAGTGAATGGATCTGG No data
1184465294_1184465304 11 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465304 22:44665441-44665463 TGAATGGATCTGGGGAGCAGGGG No data
1184465294_1184465298 -5 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465298 22:44665425-44665447 AGCACAAAGTAGGCAGTGAATGG No data
1184465294_1184465301 3 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465294_1184465302 9 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465302 22:44665439-44665461 AGTGAATGGATCTGGGGAGCAGG No data
1184465294_1184465303 10 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465303 22:44665440-44665462 GTGAATGGATCTGGGGAGCAGGG No data
1184465294_1184465300 2 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465300 22:44665432-44665454 AGTAGGCAGTGAATGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465294 Original CRISPR GTGCTCCCTGAGGCTGACCT GGG (reversed) Intergenic