ID: 1184465295

View in Genome Browser
Species Human (GRCh38)
Location 22:44665408-44665430
Sequence TGTGCTCCCTGAGGCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465295_1184465299 0 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465299 22:44665431-44665453 AAGTAGGCAGTGAATGGATCTGG No data
1184465295_1184465301 2 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465295_1184465298 -6 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465298 22:44665425-44665447 AGCACAAAGTAGGCAGTGAATGG No data
1184465295_1184465302 8 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465302 22:44665439-44665461 AGTGAATGGATCTGGGGAGCAGG No data
1184465295_1184465305 11 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465305 22:44665442-44665464 GAATGGATCTGGGGAGCAGGGGG No data
1184465295_1184465303 9 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465303 22:44665440-44665462 GTGAATGGATCTGGGGAGCAGGG No data
1184465295_1184465300 1 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465300 22:44665432-44665454 AGTAGGCAGTGAATGGATCTGGG No data
1184465295_1184465306 28 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465306 22:44665459-44665481 AGGGGGCGCCACAAATGACGTGG No data
1184465295_1184465304 10 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465304 22:44665441-44665463 TGAATGGATCTGGGGAGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465295 Original CRISPR TGTGCTCCCTGAGGCTGACC TGG (reversed) Intergenic