ID: 1184465296

View in Genome Browser
Species Human (GRCh38)
Location 22:44665415-44665437
Sequence AGCCTCAGGGAGCACAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465288_1184465296 6 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data
1184465281_1184465296 26 Left 1184465281 22:44665366-44665388 CCTCCATGGGTCAAATGTAACCA No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data
1184465283_1184465296 23 Left 1184465283 22:44665369-44665391 CCATGGGTCAAATGTAACCAGGT No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data
1184465290_1184465296 -8 Left 1184465290 22:44665400-44665422 CCGTCCACCCAGGTCAGCCTCAG No data
Right 1184465296 22:44665415-44665437 AGCCTCAGGGAGCACAAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465296 Original CRISPR AGCCTCAGGGAGCACAAAGT AGG Intergenic
No off target data available for this crispr