ID: 1184465301

View in Genome Browser
Species Human (GRCh38)
Location 22:44665433-44665455
Sequence GTAGGCAGTGAATGGATCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465297_1184465301 -7 Left 1184465297 22:44665417-44665439 CCTCAGGGAGCACAAAGTAGGCA No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465295_1184465301 2 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465293_1184465301 6 Left 1184465293 22:44665404-44665426 CCACCCAGGTCAGCCTCAGGGAG No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465288_1184465301 24 Left 1184465288 22:44665386-44665408 CCAGGTGGGGGATGCCGTCCACC No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465294_1184465301 3 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data
1184465290_1184465301 10 Left 1184465290 22:44665400-44665422 CCGTCCACCCAGGTCAGCCTCAG No data
Right 1184465301 22:44665433-44665455 GTAGGCAGTGAATGGATCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465301 Original CRISPR GTAGGCAGTGAATGGATCTG GGG Intergenic