ID: 1184465306

View in Genome Browser
Species Human (GRCh38)
Location 22:44665459-44665481
Sequence AGGGGGCGCCACAAATGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465295_1184465306 28 Left 1184465295 22:44665408-44665430 CCAGGTCAGCCTCAGGGAGCACA No data
Right 1184465306 22:44665459-44665481 AGGGGGCGCCACAAATGACGTGG No data
1184465294_1184465306 29 Left 1184465294 22:44665407-44665429 CCCAGGTCAGCCTCAGGGAGCAC No data
Right 1184465306 22:44665459-44665481 AGGGGGCGCCACAAATGACGTGG No data
1184465297_1184465306 19 Left 1184465297 22:44665417-44665439 CCTCAGGGAGCACAAAGTAGGCA No data
Right 1184465306 22:44665459-44665481 AGGGGGCGCCACAAATGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465306 Original CRISPR AGGGGGCGCCACAAATGACG TGG Intergenic