ID: 1184465934

View in Genome Browser
Species Human (GRCh38)
Location 22:44668874-44668896
Sequence CACGCGCGACCCTGCGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184465917_1184465934 19 Left 1184465917 22:44668832-44668854 CCCGGCCGGAGAGGGGACCGGGT 0: 1
1: 0
2: 0
3: 11
4: 165
Right 1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1184465920_1184465934 14 Left 1184465920 22:44668837-44668859 CCGGAGAGGGGACCGGGTGGCTG 0: 1
1: 0
2: 3
3: 19
4: 230
Right 1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1184465929_1184465934 2 Left 1184465929 22:44668849-44668871 CCGGGTGGCTGGGGTTGGGGGGC 0: 1
1: 2
2: 8
3: 91
4: 711
Right 1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1184465913_1184465934 26 Left 1184465913 22:44668825-44668847 CCGGAGGCCCGGCCGGAGAGGGG 0: 1
1: 0
2: 1
3: 28
4: 269
Right 1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
1184465918_1184465934 18 Left 1184465918 22:44668833-44668855 CCGGCCGGAGAGGGGACCGGGTG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184465934 Original CRISPR CACGCGCGACCCTGCGGAAG GGG Intronic
901629915 1:10643010-10643032 CACGGGGGTCCCTGAGGAAGTGG + Intronic
1064037449 10:11926263-11926285 CACTGGAGACCCTGGGGAAGAGG + Intronic
1072055161 10:91747842-91747864 CACTCCAGACCCGGCGGAAGAGG + Intergenic
1077103073 11:830688-830710 AACGCGCGGGCCTGCGGCAGCGG + Exonic
1081528278 11:43942077-43942099 CGCGCGCGCGCCTGCGGAGGGGG + Intronic
1084028483 11:66467158-66467180 CCCGCGCGTCCCTGCGGTCGCGG + Intronic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1103976242 12:124704723-124704745 CATGCGGGACCCTCCGGGAGGGG + Intergenic
1113200992 13:107867327-107867349 CGCGGGCGGCCCTGCGGCAGCGG - Intergenic
1113679502 13:112233411-112233433 CAGGGCCGACCCTGAGGAAGAGG - Intergenic
1121546673 14:94768392-94768414 CACGCGCTGCCTTGCGGGAGGGG - Exonic
1122884683 14:104705776-104705798 CCCGCACGCCCCTGGGGAAGGGG - Intronic
1129597612 15:76976771-76976793 CACGGGGAACCCTGAGGAAGTGG + Intergenic
1134101667 16:11456863-11456885 CTCGGGCCACCCTGTGGAAGTGG - Exonic
1141688189 16:85582124-85582146 CACCAGCGTGCCTGCGGAAGTGG - Intergenic
1142683375 17:1562773-1562795 CCCGCGCGGCGCTGCGGAACCGG - Exonic
1150414482 17:64975873-64975895 CACGGGCGACCCTGGTGACGCGG - Intergenic
1155033208 18:22002061-22002083 AATGCCCGACCCTGCGGCAGGGG + Intergenic
1155181583 18:23352866-23352888 CACTCGAGAACCTGAGGAAGGGG + Intronic
1159941597 18:74412835-74412857 CACGCCCGAGCCTGTGGAACAGG + Intergenic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1165073337 19:33268008-33268030 CACGCACCAACCTCCGGAAGTGG - Intergenic
930177321 2:48314540-48314562 CTCCCGCGACCCCGAGGAAGGGG - Intergenic
937307451 2:120881297-120881319 CAAGCAGGACCCTGGGGAAGGGG - Intronic
938934610 2:136117312-136117334 CACTCGCGGCCGTGGGGAAGAGG + Intronic
947739552 2:232478909-232478931 CATGCGTGGCCCTGCGGAGGAGG - Intergenic
948922526 2:241072442-241072464 CAGGCGCGACCCTGCCCCAGAGG + Intronic
1172832869 20:37851093-37851115 CACACACAACCCTGCGGAAATGG + Intronic
1184465934 22:44668874-44668896 CACGCGCGACCCTGCGGAAGGGG + Intronic
1002446728 5:179294662-179294684 CAGGGGCCACCCTGCGGATGTGG - Intronic
1002783151 6:382367-382389 CACCCACGGCCCTGCGGGAGTGG - Intergenic
1006575128 6:35039618-35039640 CACGTGCGTCCCTGTTGAAGTGG + Intronic
1023829556 7:44030855-44030877 CACGGGTGACCCTGCAGGAGTGG - Intergenic
1029739865 7:102485113-102485135 CACGGGTGACCCTGCAGGAGTGG - Exonic
1029757864 7:102584292-102584314 CACGGGTGACCCTGCAGGAGTGG - Exonic
1029775800 7:102683353-102683375 CACGGGTGACCCTGCAGGAGTGG - Intergenic
1038618475 8:29117567-29117589 CACGCTTGACCCTGCTGAACTGG + Intronic
1046871196 8:119207890-119207912 CACGCGCGACGCTGCCCTAGTGG + Intronic
1049694427 8:143976528-143976550 CACGCCCGAGACTGCGGAACTGG - Intronic
1051936474 9:22447617-22447639 CACGGGCGGCCCTGCGGCGGGGG + Exonic