ID: 1184466216

View in Genome Browser
Species Human (GRCh38)
Location 22:44669934-44669956
Sequence AAGCTGGGGCTCTCCAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184466203_1184466216 22 Left 1184466203 22:44669889-44669911 CCTCCGGCCTTCTGCACTCGGCG 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466200_1184466216 24 Left 1184466200 22:44669887-44669909 CCCCTCCGGCCTTCTGCACTCGG No data
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466205_1184466216 15 Left 1184466205 22:44669896-44669918 CCTTCTGCACTCGGCGCAGCCTC No data
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466211_1184466216 -7 Left 1184466211 22:44669918-44669940 CCAGAATCCTGGGGGTAAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466204_1184466216 19 Left 1184466204 22:44669892-44669914 CCGGCCTTCTGCACTCGGCGCAG 0: 1
1: 0
2: 1
3: 3
4: 116
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466202_1184466216 23 Left 1184466202 22:44669888-44669910 CCCTCCGGCCTTCTGCACTCGGC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263
1184466210_1184466216 -4 Left 1184466210 22:44669915-44669937 CCTCCAGAATCCTGGGGGTAAGC 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG 0: 1
1: 0
2: 4
3: 23
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184466216 Original CRISPR AAGCTGGGGCTCTCCAAGTG AGG Intronic
900123330 1:1058853-1058875 AAGCTGGGGTTCCCTGAGTGGGG + Intergenic
900137350 1:1123360-1123382 AAGGTGGTGCTCTCCAGATGGGG + Intergenic
900356786 1:2268800-2268822 CAGCTGGGGCTCTCTGGGTGGGG - Intronic
900368725 1:2322088-2322110 GCGCTGGGGCTCTCCGGGTGGGG + Intronic
902516532 1:16992495-16992517 CAGCTGGGGCTCCCAAAGTGGGG + Exonic
905422667 1:37859310-37859332 AAGCTGGGGGTCTCCAAGCAAGG + Intronic
905903419 1:41597346-41597368 AATCTGGGCCTCTGCAAGTCTGG - Intronic
906180157 1:43811152-43811174 AAGATGGGGCACTCTAAGTTTGG - Intronic
907615964 1:55927067-55927089 AACCTGGGACCCACCAAGTGTGG + Intergenic
908257197 1:62312716-62312738 GAGCTGGTTCTCTGCAAGTGAGG - Intronic
909600869 1:77459645-77459667 AATCTGTGGTTCTCAAAGTGTGG - Intronic
915629099 1:157138185-157138207 CAGCTGGGCCTCACCCAGTGCGG - Intronic
916895259 1:169155884-169155906 GAACAGTGGCTCTCCAAGTGTGG + Intronic
917681378 1:177371637-177371659 AACCTGAGGCTCTGCAAGAGTGG - Intergenic
919811225 1:201410056-201410078 AATCAGTGGTTCTCCAAGTGTGG - Intronic
920258401 1:204672360-204672382 AAGATAGGGCTCCCCAAGTGGGG + Intronic
922472817 1:225887431-225887453 CAGCTGGGGCTCCCCAAGCCCGG + Exonic
922480829 1:225939393-225939415 CAGCTGGGGCTCCCCAAGCCCGG + Exonic
922695493 1:227728982-227729004 GAGCTGCGGCTCTCTAGGTGGGG + Intronic
922981892 1:229834020-229834042 AGGCTGTGGTTCTCAAAGTGTGG - Intergenic
924624134 1:245686089-245686111 AGGCTGGGGCTCTGCACGAGTGG - Exonic
1064856802 10:19777667-19777689 AAACTGGGGCTCACCAAGAGGGG + Intronic
1065186090 10:23172502-23172524 AAGCTGGGGCAGACCAAGGGCGG + Intergenic
1067467972 10:46515335-46515357 AAGTTGGGGTTCTCCAGGTTTGG + Intergenic
1067935391 10:50607574-50607596 AAGCTTTGGCTCTAAAAGTGTGG - Intronic
1068813484 10:61283211-61283233 CAGCAGTGGTTCTCCAAGTGTGG + Intergenic
1069688496 10:70334583-70334605 AAGCTGCTGCTGTCCACGTGTGG - Intronic
1069888909 10:71640892-71640914 AAACAGTGGTTCTCCAAGTGTGG - Intronic
1073441701 10:103556181-103556203 AAGCAGGAGCTCTGCAAATGGGG - Intronic
1073694538 10:105849970-105849992 AAGCAGTGGTTCTCCCAGTGTGG + Intergenic
1074466991 10:113692200-113692222 ATGCTATGGCTCTCCATGTGTGG + Intronic
1076175773 10:128366808-128366830 AAGCTGGGTCTTTCCAAGCATGG - Intergenic
1076427810 10:130380049-130380071 AAGCTAATGATCTCCAAGTGGGG - Intergenic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1080588152 11:33699825-33699847 AAACCGGGGCTCTCCATGGGGGG - Intronic
1083540493 11:63508748-63508770 GAGGTGAGGCTCTCAAAGTGCGG - Intronic
1088546505 11:110964831-110964853 AAGCTGGGACCTTCCAAATGGGG + Intergenic
1089933855 11:122343266-122343288 AAGCAGGAGCTCTTCAAGTTGGG - Intergenic
1090938171 11:131363928-131363950 AGGGTGGGGCTCTGGAAGTGGGG - Intergenic
1092527334 12:9317220-9317242 ATGCTGGGGTCCCCCAAGTGAGG + Intergenic
1092539942 12:9414553-9414575 ATGCTGGGGTCCCCCAAGTGAGG - Intergenic
1092727167 12:11497791-11497813 ACGCTGGGGCCCACCATGTGAGG - Intronic
1092755048 12:11755494-11755516 CAGCTGGGACTTTCCAAATGAGG + Intronic
1092886692 12:12930506-12930528 AAGGTGGAGCCCTCGAAGTGTGG - Intergenic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1095410427 12:41915115-41915137 AAGCTGGGCCATTCCAAGTCAGG + Intergenic
1095801088 12:46269891-46269913 GAGCTGGGGCGCTCCAAGTCCGG + Intronic
1095954834 12:47799973-47799995 ACGCTGGGCATCTCCCAGTGGGG + Intronic
1095964758 12:47859137-47859159 AATCTTGGGCTCCCCAAGCGAGG - Intronic
1096650537 12:53060062-53060084 TAGCTGTGGCTCTCCAGGAGAGG + Exonic
1097145658 12:56937703-56937725 CAACTGGGGCTCTCCAAGGCTGG - Intergenic
1098384800 12:69907471-69907493 TAGCTGGGGCCCTGCAGGTGGGG + Intronic
1098607825 12:72415161-72415183 CAGCAGTGGTTCTCCAAGTGAGG - Intronic
1099440676 12:82695824-82695846 AAGAAGGGGTTCTCAAAGTGGGG + Intronic
1100085203 12:90902101-90902123 AAACTGAGGCTCTGCATGTGAGG + Intergenic
1100283470 12:93140795-93140817 AGGCTTTGGCTCCCCAAGTGTGG - Intergenic
1101309638 12:103564400-103564422 AAGCAGGCTGTCTCCAAGTGTGG - Intergenic
1101447556 12:104748284-104748306 AAGCTGTGGTTCTCAAAGTTTGG + Intronic
1102350900 12:112191295-112191317 AAGCTGGGAATATCCCAGTGAGG - Intronic
1103364681 12:120373071-120373093 AAGCTGTGTTTCTCCAAGAGTGG - Intergenic
1103878235 12:124145858-124145880 AAGGTGGGAATCTCAAAGTGGGG + Intronic
1104391079 12:128391025-128391047 ACGCTGCGGTTCTCAAAGTGGGG + Intronic
1105436134 13:20379933-20379955 AAGCTGAGGCTCTGCAAGACTGG - Intergenic
1106592588 13:31110455-31110477 TAGCAGGGGCACTCCAGGTGCGG - Intergenic
1107726380 13:43303896-43303918 GAGCAGTGGCTCTCAAAGTGTGG - Intronic
1108598739 13:51972536-51972558 AAGCTTGGGGTCACCAAGAGGGG - Intronic
1110528764 13:76571845-76571867 AAGCTGGGGCTTTTAAAGAGAGG - Intergenic
1111408389 13:87841226-87841248 AACCTGGGACCCTCCAAATGAGG - Intergenic
1113347872 13:109498340-109498362 AGGCTGGGGGTCTCCAAGTGTGG + Intergenic
1113454605 13:110439136-110439158 AGGCTGGGGCTCTGAAGGTGAGG - Intronic
1113958530 13:114112600-114112622 AACCCGGGGCTCTCCTAGCGGGG - Intronic
1115060930 14:29188570-29188592 GAGCTGTGGTTCTCAAAGTGTGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118869088 14:69726756-69726778 AAGCTGGGGCTTTCCGGGCGTGG - Intergenic
1122738704 14:103858514-103858536 GGGCAGTGGCTCTCCAAGTGTGG - Intergenic
1125439121 15:39682534-39682556 AAGCTGGGGCTCCCCGGATGAGG + Intronic
1125862297 15:43010189-43010211 AAGGTGGGACTCACTAAGTGTGG + Intronic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1128710194 15:69865993-69866015 GAGCAGGGACTCTCAAAGTGGGG + Intergenic
1128712011 15:69879052-69879074 AGGCAGGTGCTCCCCAAGTGTGG - Intergenic
1131754337 15:95543826-95543848 AAGCAGTGGCTCTCAAAGTCTGG + Intergenic
1132237091 15:100230236-100230258 AAGATAGGGGTCTGCAAGTGTGG - Intronic
1132372862 15:101310098-101310120 CAGCTCAGGCTGTCCAAGTGGGG + Intronic
1132986150 16:2768676-2768698 AAGCTGCGGCTCTCCGAGGAAGG + Intronic
1134009258 16:10839088-10839110 AAGCTGTGGCTCTGCACCTGTGG + Intergenic
1135974532 16:27099253-27099275 ATTCTAGGGCTCTCCAAGTCAGG - Intergenic
1136098395 16:27975140-27975162 AAGGAGTGGCTCTCAAAGTGTGG - Intronic
1136121350 16:28137270-28137292 AAGCTGGGGCTGTCAAAATCTGG - Intronic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1136462505 16:30420451-30420473 AAGCTGGGGTTCGGGAAGTGTGG + Intronic
1137298474 16:47121635-47121657 AAGCTGGAGCCCTCAAAGGGAGG - Intronic
1138864391 16:60798683-60798705 AAACTGAGGCTAGCCAAGTGTGG - Intergenic
1139243216 16:65415694-65415716 GTGCTGGGGCACACCAAGTGGGG - Intergenic
1141012600 16:80416931-80416953 GAGCAGGGGTTCTCCAAATGTGG - Intergenic
1141223223 16:82090976-82090998 AGACTGGAGCTTTCCAAGTGGGG + Exonic
1141342142 16:83213122-83213144 AAGCTGGGGCCCTCACAATGGGG + Intronic
1141823983 16:86466493-86466515 AAAATGGGGCTCCTCAAGTGTGG - Intergenic
1142097170 16:88246677-88246699 AAGCGGTGGTTCTCAAAGTGTGG - Intergenic
1143223077 17:5278857-5278879 CACCTAGGGCTCTCCATGTGAGG - Intergenic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1145746633 17:27324941-27324963 AAGCTGGGAAACTCCACGTGGGG + Intergenic
1146053547 17:29569700-29569722 AAGCTGGGGCCCACAAAGTCAGG - Intronic
1147494469 17:40902812-40902834 AAGCGAGGGTTCTCAAAGTGTGG + Intergenic
1147736031 17:42638892-42638914 CAGCAGTGGATCTCCAAGTGTGG - Intergenic
1149470746 17:56913570-56913592 AAGGCGGGGCTGTCGAAGTGCGG + Exonic
1150021378 17:61617396-61617418 GAAGTGCGGCTCTCCAAGTGGGG - Intergenic
1153791699 18:8584990-8585012 CAGGTCGGGCTCTCCAAGTAGGG - Intergenic
1153880808 18:9420287-9420309 GGCCTGGGGCTCCCCAAGTGAGG - Intergenic
1155590622 18:27423111-27423133 AAGCTGGAGCTCTGCAGGTGGGG + Intergenic
1157826077 18:50813594-50813616 ATGCAGTGGTTCTCCAAGTGTGG - Intronic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1160951127 19:1667845-1667867 CAGCTGGGGCTCTGGCAGTGGGG + Intergenic
1163385102 19:16995100-16995122 AAGCTGGGGCCCTCAAAGCCAGG + Intronic
1163839538 19:19598118-19598140 AAACTGGGGAACTCCAAATGAGG + Intronic
1164523277 19:28995093-28995115 AGCCTGTGGTTCTCCAAGTGTGG - Intergenic
1164589059 19:29496148-29496170 AGGCTGGGGCTCTCCTGGAGGGG + Intergenic
1165542510 19:36503962-36503984 AAACTGGGGCACTCTATGTGTGG + Intergenic
1165695093 19:37894899-37894921 AAGCTGGGGAAATCCAAGTTTGG - Exonic
1166146868 19:40844049-40844071 CAGCTGCGGCTCTCCCAGGGAGG + Intronic
1166151029 19:40875946-40875968 CAGCTGCGGCTCTCCCAGGGAGG + Intronic
1166155523 19:40908725-40908747 CAGCTGCGGCTCTCCCAGGGAGG + Intergenic
1167604724 19:50475755-50475777 GAGCAGGGGCTTTCCAAGTCAGG + Intronic
1168297218 19:55383437-55383459 AAGCTGGGGCTCTCCCCGTGCGG + Intronic
925201324 2:1969555-1969577 GAGCCGGGGTTCCCCAAGTGGGG - Intronic
925409684 2:3632811-3632833 ACGCTGCCCCTCTCCAAGTGGGG - Intronic
925500264 2:4495890-4495912 ATGTTGGGGCCATCCAAGTGTGG - Intergenic
925905506 2:8537580-8537602 AAGCTGGGGCTCCTCAGATGGGG + Intergenic
925905914 2:8539659-8539681 AGGCTGGGACCCCCCAAGTGGGG - Intergenic
926192506 2:10739389-10739411 AAGCTAGGGGTCTGGAAGTGAGG - Intronic
928374532 2:30764131-30764153 AACCTGTGCCACTCCAAGTGGGG - Exonic
928668573 2:33576888-33576910 AACCTTGGCCTCTCAAAGTGCGG + Intergenic
930432457 2:51296775-51296797 AAGGTGGGTCTTTCCATGTGTGG + Intergenic
932182426 2:69659975-69659997 AAGCTGGAACTCTCAAAGAGTGG + Intronic
933458389 2:82546657-82546679 ATTCTTGGGCTCTCCAAGTGGGG - Intergenic
933727504 2:85435096-85435118 CAGCTGAGGCACTCCCAGTGGGG - Exonic
937228303 2:120382400-120382422 ATGCTGTGGCCCTCCAAGTGTGG + Intergenic
937438236 2:121896628-121896650 GAGCAGGGGTTCTCAAAGTGGGG + Intergenic
938107123 2:128540094-128540116 AAGCTGATGCTTTCCAAATGGGG - Intergenic
938304925 2:130246809-130246831 AGGCTGGGGCTCTCCATAGGAGG - Intergenic
938380719 2:130835124-130835146 AACCAGGGGTTCTCTAAGTGTGG + Intergenic
940130813 2:150379549-150379571 AAGCAGAGGTTCTCAAAGTGTGG + Intergenic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
941433546 2:165440038-165440060 AATCTGTGGCTCTCAAAATGTGG + Intergenic
941477785 2:165969902-165969924 AAGCAGTGGCTTTCAAAGTGTGG - Intergenic
942244911 2:173999037-173999059 CAGCTGTGGCTCTTCAAGGGTGG + Intergenic
943598265 2:189883250-189883272 GAGCAGTGGTTCTCCAAGTGTGG - Intronic
944674547 2:202024121-202024143 AAGCTAGGACTTTCCAAGTAGGG - Intergenic
945248178 2:207740075-207740097 AACCAGTGGTTCTCCAAGTGTGG - Intronic
945748146 2:213744414-213744436 AAGCTTGAGCTCTCCAAGCTTGG + Intronic
1168838221 20:891840-891862 GAGCTGTGTTTCTCCAAGTGTGG + Intronic
1171164046 20:22955245-22955267 GAGCTGTGGCTTTCAAAGTGTGG + Intergenic
1171178694 20:23075267-23075289 AAGCAGCGGTTCTCCAAGGGCGG + Intergenic
1171274573 20:23845189-23845211 AAGCAGGTGCTCTACAAGTCTGG - Intergenic
1173026045 20:39308513-39308535 AATCTGCGGCTTTACAAGTGGGG - Intergenic
1173033226 20:39381531-39381553 AAGCAGTGGTTCTCTAAGTGTGG - Intergenic
1173121819 20:40299592-40299614 AGGCTGCCTCTCTCCAAGTGTGG - Intergenic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1175085601 20:56456076-56456098 AAGCGGGGGCTTTCCAAGTGAGG - Intronic
1175137679 20:56837033-56837055 AAGCTGGGTCTTTCCAAGCTGGG + Intergenic
1175257885 20:57657872-57657894 GAGCCGGGGCTCACCAGGTGTGG - Intronic
1176115000 20:63428342-63428364 CAGCTGGGGAGCTCCAGGTGGGG - Intronic
1177812638 21:25940968-25940990 GAGCTGTGGTTCTCCAAGTGTGG - Intronic
1180611208 22:17099399-17099421 AAGCAGTGGGTCTCAAAGTGTGG + Intronic
1180756391 22:18164839-18164861 AAGCTGGGGCTGCCTATGTGTGG + Intronic
1181014769 22:20062526-20062548 CAGGTGGGGCTCTTCCAGTGAGG - Intronic
1181075378 22:20372595-20372617 AAGCTGGGGCTGCCTATGTGTGG - Intronic
1181114932 22:20626103-20626125 AAGCTGGGCCGCTGCAGGTGAGG + Intergenic
1181692100 22:24568997-24569019 AAGATGGGCCTCTCCAGGTGCGG - Intronic
1182521042 22:30884672-30884694 GAGCTCGGGCTCTCCCTGTGGGG + Intronic
1182678098 22:32055876-32055898 AGGATGGGGCTCTCAAACTGTGG + Intronic
1183830504 22:40416243-40416265 AACCTGGCTCTCTCCAAATGGGG + Intronic
1184314097 22:43669792-43669814 AGGCAGGGGCTCACAAAGTGTGG + Intronic
1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG + Intronic
1184738623 22:46413855-46413877 AAGGTGGGGCTCACAAAGTGAGG - Intronic
949748644 3:7325514-7325536 AAGCAGAGGTTCTCAAAGTGTGG - Intronic
949867134 3:8555390-8555412 CAGATGGGGCTCACTAAGTGGGG - Intronic
950401028 3:12769137-12769159 TGGCGGGGCCTCTCCAAGTGCGG + Intronic
950559703 3:13714477-13714499 AAGATGGGTCTCTTCAAATGGGG - Intergenic
950614645 3:14148892-14148914 CAGCTGGGGCTCAGCAAGTCGGG + Exonic
950720548 3:14879500-14879522 AAGCTGGGGCTCACCATCTGAGG + Intronic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952529558 3:34249252-34249274 AAGTAGTGGCTCTCAAAGTGTGG + Intergenic
952576556 3:34781159-34781181 AAGCAGTAGTTCTCCAAGTGTGG - Intergenic
954061159 3:48068497-48068519 AAGCTGGGACTGGCCAGGTGTGG + Intronic
956245188 3:67175026-67175048 AATCTGGTGATCTCAAAGTGGGG - Intergenic
956363985 3:68480027-68480049 AAGCATTGGCTCTCAAAGTGTGG + Intronic
958196240 3:90245456-90245478 ATGCTGCGGCTCTCAAAGTTTGG + Intergenic
958638737 3:96778391-96778413 AAACTGGGGTCCACCAAGTGGGG + Intergenic
959525850 3:107375647-107375669 AGGCAGTGGCTCTCAAAGTGTGG + Intergenic
960544272 3:118894729-118894751 AAGCTGGGATTCCCCCAGTGGGG + Intergenic
961325824 3:126108688-126108710 AAGCAGGAGCTCTCCAGGTGGGG + Intronic
961454638 3:127017952-127017974 GAGCTGGGGCTGTGCTAGTGGGG - Intronic
961487775 3:127229070-127229092 TGGCTGGGGCTCTCAAAGTGTGG - Intergenic
961871808 3:129993819-129993841 AAGCAGTGCATCTCCAAGTGTGG + Intergenic
961960121 3:130845852-130845874 AACCAGTGGCTCTCAAAGTGAGG + Intergenic
962223936 3:133588745-133588767 AAACTGGGGTCCACCAAGTGGGG + Exonic
963335643 3:143971664-143971686 AAGCTCGGGCTCTTGAGGTGGGG - Intergenic
963846087 3:150159544-150159566 CATCTGGGCCTCCCCAAGTGTGG + Intergenic
964293115 3:155203601-155203623 AGGGTGGGGCTTTCAAAGTGAGG + Intergenic
967005642 3:185379825-185379847 AGGCTGTGGTTCTCAAAGTGTGG + Intronic
968189849 3:196659884-196659906 AGGCTGAGGCTCTCCAGGAGAGG - Exonic
968405173 4:334766-334788 AAGCTGAGGCTCAGCAAATGAGG - Intergenic
968784250 4:2607773-2607795 GAGCTGTGGTTCTCAAAGTGTGG - Intronic
968957642 4:3727297-3727319 AAGCTGGGGCGCTCCAGGGTGGG - Intergenic
969583378 4:8078262-8078284 AGGCCAGGCCTCTCCAAGTGTGG - Intronic
970569767 4:17368307-17368329 TACCTGGGGCTCTACGAGTGTGG + Intergenic
973729094 4:53805804-53805826 AATCAGGGGTTCTCAAAGTGTGG + Intronic
976195544 4:82528422-82528444 GAGCTGTGGTTCTCAAAGTGTGG - Intronic
978368211 4:108004586-108004608 AATCTGGGGTTCTTCAAGTTTGG - Intronic
979450503 4:120865176-120865198 AATTTGGGACACTCCAAGTGGGG + Intronic
983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG + Intronic
984206959 4:176797039-176797061 AAGGTGGGTCTTTCAAAGTGGGG - Intergenic
986275115 5:6267609-6267631 AAGCTGGGGCTTTCTGAGAGAGG - Intergenic
986622646 5:9691669-9691691 AGGCTGGGGCTGGCCAGGTGGGG + Intronic
989365685 5:40652864-40652886 GAGCTCTGGCTTTCCAAGTGAGG - Intergenic
997781119 5:136659691-136659713 AAGCTGGCAGTCTCCATGTGTGG + Intergenic
998453086 5:142249776-142249798 GACCAGGGGCCCTCCAAGTGTGG + Intergenic
999240307 5:150123898-150123920 AAGCTGGTGGTCTCCAATGGTGG + Intronic
1001077031 5:168637657-168637679 AAGCTGGGGCTCTCTGAAGGAGG - Intergenic
1001097181 5:168784736-168784758 AAGCTGGGGCTCTAAAGGGGTGG - Intronic
1001102923 5:168829008-168829030 AAGTTGGAGCTCTCCAAAGGTGG - Intronic
1001795157 5:174496010-174496032 AAGCTGGGGCACTAGAAATGTGG - Intergenic
1003236038 6:4295819-4295841 GAGCAGGGGTTCTCAAAGTGGGG + Intergenic
1004065982 6:12244819-12244841 GAGCAGCGGCTCTCAAAGTGTGG - Intergenic
1004585648 6:16997248-16997270 GAGCTGGAGCTCGCTAAGTGAGG + Intergenic
1007406179 6:41637543-41637565 AGCCTGCGGCTCTCCAGGTGGGG - Intronic
1007701133 6:43767253-43767275 AAGGTGAGGCCCTCCAAGCGGGG + Intergenic
1008019116 6:46555822-46555844 AATCTGGAGCACTCCAGGTGTGG + Intronic
1008824346 6:55674643-55674665 AATTTGGGGCTCTACAAATGAGG + Intergenic
1009707292 6:67267968-67267990 AACTTGGAGCTCTCCCAGTGTGG - Intergenic
1011119233 6:83932550-83932572 CACGTGGGGCTCTCCAAGTGTGG - Intronic
1011727572 6:90225918-90225940 AAGCAGTGGTTCTCCAAGCGGGG + Intronic
1012211175 6:96520845-96520867 AAGCGGGGCAACTCCAAGTGGGG + Intergenic
1012925409 6:105262301-105262323 AAACTGAGGCTCTTGAAGTGAGG + Intergenic
1013514518 6:110874094-110874116 AAGCCGGGGCCCTCCAAGGCTGG + Intronic
1014143958 6:117975041-117975063 CATCAGTGGCTCTCCAAGTGTGG - Intronic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1016310504 6:142728486-142728508 TAACTGGGGCTCCTCAAGTGAGG + Intergenic
1016452955 6:144202448-144202470 AGCCTGTGGCTCTCAAAGTGTGG - Intergenic
1018331887 6:162738085-162738107 AAGCTGTGGCTCTCTTAGTGAGG - Intronic
1022049139 7:26648038-26648060 AAGCTCGTGTTCTCCCAGTGTGG - Intergenic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1025924543 7:65946393-65946415 CAGCTATGGATCTCCAAGTGTGG + Intronic
1025931863 7:66001622-66001644 CAGCTATGGATCTCCAAGTGTGG + Intergenic
1027130067 7:75584434-75584456 AAGCTGGTATTGTCCAAGTGTGG - Intronic
1028605599 7:92651865-92651887 GAGCTGGGGCACTCCAAGGAGGG + Intronic
1028888508 7:95960942-95960964 AAGCATGGGCTCTAGAAGTGAGG + Intronic
1032415823 7:131734673-131734695 ACTCTGGGGCTCACCAAGTGTGG + Intergenic
1032459193 7:132096908-132096930 AAGCTGGGGCTTTCACAATGTGG + Intergenic
1032729026 7:134619142-134619164 AAGCCAGGACTCCCCAAGTGGGG - Intergenic
1033238070 7:139654176-139654198 AAGCTGCTGCTATACAAGTGAGG + Intronic
1035296654 7:157871189-157871211 AAGCTGTGGTTCTCAAAGTGGGG + Intronic
1037623651 8:20589186-20589208 ACACTGTGGTTCTCCAAGTGTGG + Intergenic
1039143887 8:34423633-34423655 AAGCTGGGGCTGTTCAAGTTGGG - Intergenic
1039907645 8:41798213-41798235 AGGCTGGAGCTCTCCAAGGCCGG + Intronic
1039917775 8:41872478-41872500 AAGCTGGGGGTCTGGAATTGGGG - Intronic
1042841300 8:73126583-73126605 AAGCAGGGATTCTCCAAGTGTGG + Intergenic
1043865274 8:85367704-85367726 AAGCAGTGGCTCTCTAAGTGTGG - Intronic
1044755570 8:95457896-95457918 AGGGTGGGGTTCTCCATGTGAGG - Intergenic
1045217041 8:100158559-100158581 AAGCTGGGTCTCTCCCACCGAGG - Exonic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1053257705 9:36632222-36632244 AATCTGTGGTTCTCAAAGTGTGG - Intronic
1053602937 9:39629164-39629186 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1053860586 9:42382912-42382934 AAACTGTGTTTCTCCAAGTGTGG - Intergenic
1054250600 9:62713272-62713294 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1054564708 9:66747784-66747806 AAACTGTGTTTCTCCAAGTGTGG + Intergenic
1055400474 9:75918456-75918478 AATCAGTGGCTCTCAAAGTGTGG - Intronic
1055480098 9:76701215-76701237 AAACTGTGGTTCTCTAAGTGGGG - Intronic
1055649498 9:78393356-78393378 AAGGTGGGAATCTCAAAGTGGGG + Intergenic
1056260527 9:84843578-84843600 AAGGTGTGGCTCTCCAAAGGTGG + Intronic
1057788908 9:98109674-98109696 ATGAAGGGGCTCTGCAAGTGAGG - Intronic
1059504071 9:114781985-114782007 GAGCTGGGGCTCCCCAGGTTGGG + Intergenic
1062371729 9:136242756-136242778 AGGCTGGGACTCTCAAAGTAGGG - Intronic
1203377283 Un_KI270442v1:385695-385717 CGCCTGGGGCTCTCCCAGTGGGG - Intergenic
1185747341 X:2583790-2583812 AAGTTGGGGCTCCCCAACCGTGG + Intergenic
1186791914 X:13007954-13007976 AAGCTGGAGCCTTCCAAGGGAGG - Intergenic
1187147737 X:16653333-16653355 AAGCAGTGGTTCTCCAAGTGTGG + Intronic
1187305356 X:18090453-18090475 AAGCAGGGGCTCTCAAATTGTGG - Intergenic
1187966208 X:24614906-24614928 ATGCTGTGGTTCTCAAAGTGTGG + Intronic
1188107453 X:26161399-26161421 AAGCTGGGTCTCTCCAATGAAGG + Intergenic
1189219811 X:39361886-39361908 AAGCTGCTGCTCTGCAAGTCTGG + Intergenic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1190497809 X:51043443-51043465 AGGCAGGGGCTCCTCAAGTGTGG - Intergenic
1191253397 X:58269741-58269763 AAGCTGGGGTACTCCCAGGGAGG - Intergenic
1195654677 X:107323640-107323662 AAGCACTGGTTCTCCAAGTGTGG + Intergenic
1198459637 X:136850633-136850655 AACATGGGGCTCTCCTCGTGTGG + Intronic
1199611251 X:149616606-149616628 ATGATGGGGTTATCCAAGTGGGG - Intronic
1200818468 Y:7557494-7557516 AACCTGTGGATCTGCAAGTGTGG - Intergenic