ID: 1184467414

View in Genome Browser
Species Human (GRCh38)
Location 22:44677013-44677035
Sequence TCACATGGCCAAAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 8, 3: 85, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184467414_1184467422 16 Left 1184467414 22:44677013-44677035 CCCTCTGCCCTTTGGCCATGTGA 0: 1
1: 0
2: 8
3: 85
4: 511
Right 1184467422 22:44677052-44677074 AAGCCATTCGGCTGCCCCCAAGG 0: 1
1: 0
2: 0
3: 6
4: 74
1184467414_1184467424 21 Left 1184467414 22:44677013-44677035 CCCTCTGCCCTTTGGCCATGTGA 0: 1
1: 0
2: 8
3: 85
4: 511
Right 1184467424 22:44677057-44677079 ATTCGGCTGCCCCCAAGGCCAGG 0: 1
1: 0
2: 0
3: 9
4: 96
1184467414_1184467420 4 Left 1184467414 22:44677013-44677035 CCCTCTGCCCTTTGGCCATGTGA 0: 1
1: 0
2: 8
3: 85
4: 511
Right 1184467420 22:44677040-44677062 CTCCTAATGTGTAAGCCATTCGG 0: 1
1: 0
2: 1
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184467414 Original CRISPR TCACATGGCCAAAGGGCAGA GGG (reversed) Intronic
900187060 1:1337545-1337567 TCACATGGCCCATGGCCACATGG + Intronic
901332946 1:8424300-8424322 TCACCTGCCCACCGGGCAGAGGG + Intronic
901806832 1:11743867-11743889 GCACATAGAAAAAGGGCAGATGG - Intronic
902521744 1:17021938-17021960 GAACCTGGCCAAAGGGCAGCCGG + Intronic
903001845 1:20271989-20272011 TCCCATCAGCAAAGGGCAGATGG + Intergenic
903410483 1:23139360-23139382 ACAGATGTACAAAGGGCAGAAGG + Intronic
904011160 1:27391446-27391468 TCCCCTGGACTAAGGGCAGATGG + Intergenic
904672088 1:32173632-32173654 TTACATGGCCAAAGGAGAGGAGG - Exonic
906208750 1:44000715-44000737 ACACATGGCCAAGGGGCAGCGGG + Intronic
907151241 1:52290199-52290221 TCCCATGGCAGAAGGGCAAATGG + Intronic
907890695 1:58633635-58633657 TCCCATGGTAGAAGGGCAGAAGG - Intergenic
907909003 1:58810800-58810822 TCCCTTTGCCAAATGGCAGAAGG - Intergenic
908020350 1:59892102-59892124 TCACATGGCAGAAAAGCAGAAGG - Intergenic
908568465 1:65383528-65383550 TCACATTGGCCAAGGGCAGAGGG + Intronic
908775892 1:67639605-67639627 CCACATGGACAAAGGCCACATGG + Intergenic
909301704 1:74020886-74020908 TCACATGGCAGAAGGGGTGAGGG + Intergenic
909395194 1:75163899-75163921 TCACATGGCTGAAGGCCAAAGGG - Intergenic
910084247 1:83380293-83380315 TCACATGGTGAAAGGGATGAAGG + Intergenic
910090823 1:83461884-83461906 TCACATGGTCAAAGGGGTGAGGG + Intergenic
910476167 1:87609693-87609715 TCACATGGCTGAAGGGCAGAAGG + Intergenic
910833444 1:91483518-91483540 TCACATGGCAGATAGGCAGAAGG + Intergenic
911250553 1:95571665-95571687 TCTCCTGGCAAAAGGGAAGAAGG - Intergenic
911313025 1:96319670-96319692 TTACATGGCAAAAGATCAGAAGG - Intergenic
911500933 1:98683563-98683585 TCACATGGTAAAAGGGGGGAGGG - Intronic
911712790 1:101094958-101094980 TCACATGGCAAAAGGAGTGAGGG + Intergenic
911936802 1:103986631-103986653 TCACATGGCAAAATGGGAAAAGG - Intergenic
913173104 1:116249955-116249977 TCACATGGCGGAAGGGCTGAGGG - Intergenic
914343877 1:146781803-146781825 TCACATGGCCAGAAGGCGGTGGG + Intergenic
914437997 1:147677644-147677666 TCATATGATGAAAGGGCAGAAGG + Intergenic
915319084 1:155046341-155046363 TCACCTGGCCAAGGAGCAGGAGG - Exonic
915524935 1:156469973-156469995 CCTCATGCCCAAGGGGCAGAGGG + Intronic
916086135 1:161270908-161270930 TCACATGGTAGAAGGGGAGAGGG - Intronic
916167823 1:161979053-161979075 TCACATGGCCAAAGGGGCAAGGG + Intergenic
916224713 1:162477848-162477870 TGACATGCTCAAAGGGCTGAAGG + Intergenic
916970809 1:170013059-170013081 TCACATGGCAGAAGGGGAAATGG - Intronic
919024152 1:192146665-192146687 TCACATGGCAGAAGGGATGAGGG - Intergenic
919033353 1:192274245-192274267 ACATATGGCCAATGGCCAGAGGG + Intergenic
919485032 1:198135123-198135145 TCACATGGCAGAAAAGCAGAAGG - Intergenic
920078367 1:203353511-203353533 TCACATAGGCGAAGGGCAGGAGG + Intergenic
920233184 1:204483834-204483856 TCACATGGGCAAGGGGCTGGTGG - Intronic
920497747 1:206467579-206467601 TCACAAGGGCAAAGGGCTGAGGG - Intergenic
920650603 1:207834445-207834467 TGAGAAGGCCAAAGGGCAGCCGG + Intergenic
921955937 1:220983425-220983447 TCACATTGCTAAAGTGCAGGAGG + Intergenic
922214566 1:223509778-223509800 TCACGTGGCTGAAGGGCAGCAGG - Intergenic
922437702 1:225622648-225622670 TCATATGGCAGAAGGGCAAAAGG + Intronic
922529746 1:226335404-226335426 TCACATGGCGAAAGGGGACAGGG - Intergenic
923032622 1:230262314-230262336 ACAGATGGTCAAAGGGCAAAAGG - Intronic
923125044 1:231027403-231027425 ACACATGGCAAAAGTTCAGACGG + Intronic
923128637 1:231055797-231055819 TCACATGGTAGAAGGGCAAAAGG + Intergenic
923179383 1:231501276-231501298 TCACATGGCAGAAAGGCAAAAGG + Intergenic
923775782 1:236977394-236977416 TCAGATGGCAAAAGGGGTGACGG + Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1062833813 10:623515-623537 ACACAAGGCCAAGGGGAAGAGGG + Intronic
1063023554 10:2155015-2155037 TCACATGGTGGAAGGGGAGAAGG - Intergenic
1063089059 10:2845420-2845442 TCACATGGCGGAAGGGGTGAGGG + Intergenic
1063276835 10:4578448-4578470 TCACATGGCAGAAGGGGTGAGGG + Intergenic
1063914595 10:10868581-10868603 TCACATGGCAGAAGAGGAGATGG + Intergenic
1064124807 10:12650610-12650632 GGACATGGCAAAAGGGCAGTGGG + Intronic
1064279287 10:13936555-13936577 TCACATGGCAGAAGGGGTGAGGG - Intronic
1064630969 10:17310374-17310396 TCACATGGCAAAAGGGTGGATGG - Intergenic
1066108936 10:32179524-32179546 TCACAAGCCCAAATGTCAGAAGG - Intergenic
1066638398 10:37531029-37531051 TCACATGGCGAGAGGGAAGGAGG + Intergenic
1068117650 10:52752035-52752057 CCACATGGCCACAGGGCATGTGG - Intergenic
1068265626 10:54644873-54644895 TCACATAGCAGAAGGGCAAAAGG - Intronic
1070577204 10:77688103-77688125 GCACAAGGCAAAAGGGCAAAAGG - Intergenic
1071158210 10:82715900-82715922 TCACATGGCAAAAAGACAGGGGG + Intronic
1073027647 10:100499796-100499818 TCTCATGTGCAAAGGGCAGGGGG - Intronic
1073487452 10:103828677-103828699 ACACTTGGCCATAGGGCTGATGG - Intronic
1073843134 10:107521074-107521096 TCATATGGCTAAAGGGGTGAGGG + Intergenic
1074127517 10:110541037-110541059 ACAGATGGCCAAAGGGAATATGG - Intergenic
1074482759 10:113840616-113840638 TTTCATGGCCAAAGGGAGGAGGG - Intronic
1074839504 10:117335207-117335229 TGACATAGCCAAAGTGCTGAAGG + Intronic
1075003535 10:118814847-118814869 TCACATGGCAGAAGGGGTGAGGG + Intergenic
1075436195 10:122444683-122444705 TCACATGGCAGAAGGGGTGAAGG + Intergenic
1075593287 10:123708165-123708187 TCACATGGCAGAAGGGGACAAGG - Intronic
1076798266 10:132809151-132809173 TCGCCTGGCCAAGGGGTAGAGGG - Intronic
1077057136 11:599675-599697 GCACATGGCCACAGGGCTGCTGG - Intronic
1078445353 11:11400665-11400687 TCACATGGCAAAAGGGGCAAAGG + Intronic
1078649109 11:13170761-13170783 CAACATGGCCAAAGAGCAGTGGG + Intergenic
1078836155 11:15032096-15032118 TCACATGGCCAAAGGCTGAAGGG - Intronic
1078836630 11:15036371-15036393 TCACATGGCCAAAGGCTGAAGGG - Intronic
1078964750 11:16325888-16325910 TCACATGGCGGAAGGGTGGAAGG - Intronic
1079111202 11:17606157-17606179 TGAGAGGGCCAAAGGGCCGAGGG - Intronic
1079442876 11:20533246-20533268 CCACAAGGCCAAAGGGCTCAGGG + Intergenic
1080001309 11:27353290-27353312 TAAAATGGCCAAAGGCAAGATGG + Intronic
1080088229 11:28312725-28312747 TCTCATGGCAGAAAGGCAGAAGG + Intronic
1080250110 11:30224431-30224453 TCACATGGGCAAAGGAAAGGAGG + Intergenic
1080307786 11:30855011-30855033 TCACATGGCAGAAGGCGAGAGGG - Intronic
1081684685 11:45034140-45034162 TCACATGGCAGAAGGGCAAAAGG + Intergenic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1081952084 11:47053144-47053166 TCACATGGATAAAGGAGAGAAGG + Intronic
1082812274 11:57485577-57485599 TAACATCTCCAAAGGTCAGAGGG - Intronic
1083838825 11:65291279-65291301 TCTCATGGCTAAAAGGCGGAAGG - Intronic
1084158348 11:67328989-67329011 TCACATGGCAGAAAAGCAGAAGG + Intronic
1084404855 11:68965747-68965769 TCACATGGCTGAAGGGCAAAAGG + Intergenic
1085007164 11:73102712-73102734 TCACATGGCAGAAAGGTAGAAGG - Intronic
1085235902 11:75015222-75015244 TCACATGACTGAAGGGCAAAGGG - Intronic
1085542152 11:77281660-77281682 TCACAGGGCTACAGGGGAGAAGG + Intronic
1085728247 11:78974170-78974192 TCATATGGCCACAGGCCACATGG + Intronic
1086251105 11:84815364-84815386 TGACATCTCCAAGGGGCAGAAGG + Intronic
1086469878 11:87096822-87096844 GCACATGGCTAAAAGACAGATGG - Intronic
1086823450 11:91465730-91465752 TTACATGGCAGAAGAGCAGAAGG - Intergenic
1087149340 11:94844577-94844599 TTGCATGGCCAAAGGGCAGAAGG + Intronic
1087462338 11:98461527-98461549 TCACATAGCAGAAGTGCAGAAGG - Intergenic
1088140622 11:106611703-106611725 TCTCAAGACCAAAGGGCATAGGG + Intergenic
1088251556 11:107865429-107865451 TCACATGGGAAAAGAGCATATGG + Intronic
1089200255 11:116720477-116720499 ACACAGAGCCAAAGGGGAGAGGG - Intergenic
1089658796 11:119972186-119972208 TCACATGGCAGAAGGGCAGAAGG - Intergenic
1089835722 11:121368812-121368834 TAGCATGGCAATAGGGCAGAGGG - Intergenic
1089868366 11:121651476-121651498 TCACATGGAGAAAGGGGTGAGGG + Intergenic
1090570115 11:128036548-128036570 TCACATGGACAAAGGGAAACAGG + Intergenic
1091516815 12:1192579-1192601 AGCCATGGCCAAGGGGCAGAAGG - Intronic
1092494002 12:8973442-8973464 TCATATGGGCAGAAGGCAGAAGG - Intronic
1092517911 12:9235135-9235157 TCACAGGGACAAAAGGCAGATGG - Intergenic
1092775499 12:11941850-11941872 TCCCATGGTGGAAGGGCAGAAGG - Intergenic
1093177721 12:15931935-15931957 TAACATGGCAAAAGGTCAAAGGG - Intronic
1093754128 12:22833332-22833354 TGACATGGCAAAGGGGCAAAAGG - Intergenic
1095041983 12:37453521-37453543 TCACATGGCATAAGGGCAAAAGG + Intergenic
1095578802 12:43771016-43771038 TCTCATGGTGGAAGGGCAGAAGG - Intronic
1095636244 12:44436930-44436952 TAACATGACCAAAGGTCAAAGGG - Intergenic
1095788270 12:46135140-46135162 TCACATGGCAGAAAAGCAGAAGG - Intergenic
1096919724 12:55071285-55071307 TCACATGGCAGAAGAGCAGAAGG + Intergenic
1098535777 12:71592175-71592197 TCACATGGTAGAAGGGCTGAGGG - Intergenic
1098771406 12:74558441-74558463 TCACAAGGCCACAGGAGAGAGGG + Intergenic
1099013880 12:77323234-77323256 TTACATGGACAAAGGGTAAAAGG - Intergenic
1099393317 12:82106451-82106473 TCACATTGCAAAAGGGCACATGG + Intergenic
1099729535 12:86483130-86483152 TCACATGGCAGAAGGGGTGAAGG + Intronic
1099952585 12:89320798-89320820 TCACATGGCAAAGGGGCATTTGG + Intergenic
1100261676 12:92938035-92938057 TCAGATGTCCAAAAGGGAGATGG - Intergenic
1101335898 12:103796596-103796618 GCACTTGGCCAAAGGGATGATGG - Intronic
1101385021 12:104249225-104249247 TCACATGGTGGAAGGGGAGATGG + Intronic
1101833132 12:108274820-108274842 TCCCATGGTGGAAGGGCAGAAGG - Intergenic
1101836551 12:108299670-108299692 TCACATGGACACAGAACAGAAGG + Intronic
1102090577 12:110183977-110183999 TCCCCTGGCTAAAGTGCAGAGGG - Intronic
1102205335 12:111086657-111086679 ACAAGTGGCCAAAGGGCATATGG - Intronic
1103442173 12:120971343-120971365 TGACAAGGCCAACGAGCAGAGGG + Intergenic
1104310643 12:127651541-127651563 TCACATGGCCAACAGGCAGTAGG + Intergenic
1104878220 12:132051505-132051527 TCACATGGCCACTGGACAGGGGG + Intronic
1105284308 13:18992332-18992354 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284837 13:18995375-18995397 GCAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284908 13:18995804-18995826 ACAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284990 13:18996282-18996304 TCAGAAGACCAGAGGGCAGAAGG + Intergenic
1105285071 13:18996737-18996759 CCACATGGCCAGAAAGCAGAAGG + Intergenic
1105517237 13:21101672-21101694 TCACATGGCCAAAGAAGTGAGGG + Intergenic
1107414045 13:40184629-40184651 TCACATGGCAGAAGGGATGAGGG + Intergenic
1108458744 13:50643775-50643797 TCACATGGCGAGGGGGCTGAGGG + Intronic
1108614030 13:52113856-52113878 TCACATGGTGGAAGGGGAGAGGG - Intronic
1109846345 13:67995856-67995878 TGAAATGGCCAAATGGTAGATGG + Intergenic
1110272343 13:73604926-73604948 ACAAATGGCCCCAGGGCAGATGG + Intergenic
1112126652 13:96475893-96475915 TCACATGGCTAAAAGGAGGAAGG + Intronic
1112608034 13:100927294-100927316 TCACATGGCAAAAGGGATGAGGG - Intergenic
1113501185 13:110775711-110775733 TCACATGGCAAAAGGGATGTGGG - Intergenic
1114386022 14:22255809-22255831 TCTCATAGCCAAAAGGGAGAGGG + Intergenic
1114540841 14:23457135-23457157 TCACTTGGCAAAAGAGCAGAAGG - Intergenic
1114719634 14:24867186-24867208 TCATATGGCAAAAGGGCAAAAGG - Intronic
1114888761 14:26889031-26889053 TCATATGGTGAAAGGGCAAAGGG + Intergenic
1115791020 14:36878238-36878260 TGACATGGCCAAAAGGAAAATGG + Intronic
1116692736 14:48131228-48131250 ACACATGGACACAGGGCAGGGGG - Intergenic
1116981810 14:51179309-51179331 TCACATGGCAGAAGAGCAAAAGG + Intergenic
1117464537 14:55979222-55979244 GCACATCTCCAAATGGCAGATGG - Intergenic
1117899495 14:60517121-60517143 TCACGTGGCAGAAGGACAGAAGG - Intergenic
1118299492 14:64602472-64602494 ACAAATGGCCAATGGGAAGAGGG + Intergenic
1118736258 14:68703818-68703840 TCACAGGGCCAAGGGGCCAAGGG - Intronic
1118786121 14:69046539-69046561 TCACTAGGCCAAGGGGAAGAAGG - Intergenic
1119432289 14:74576122-74576144 TCCCAGGGCCAAGGGGCACAGGG + Intronic
1119647209 14:76356559-76356581 CCACATGGCCATGGGCCAGAAGG - Intronic
1121020591 14:90577955-90577977 TCACATGGCCTGAAGCCAGAGGG - Intronic
1121811897 14:96898772-96898794 TCACGTGGCAGAAGGGCAAAAGG + Intronic
1121853174 14:97242382-97242404 TCACATGGTGGAAGGGCAAAGGG + Intergenic
1121970542 14:98351837-98351859 TCACATGGCCAAAGGGACATGGG - Intergenic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1123214643 14:106795711-106795733 TCAAATGGCCAAAAAGCATATGG + Intergenic
1123986405 15:25650219-25650241 TCACATGGGGAAAGGGGGGATGG + Intergenic
1124047397 15:26162868-26162890 TCACATGGCCGAAGGGGCAAGGG + Intergenic
1125250980 15:37703849-37703871 TAGCATGGACAAAGTGCAGAAGG - Intergenic
1125416534 15:39459865-39459887 TCACATGACCAAAGGACTGAGGG + Intergenic
1125803698 15:42473752-42473774 TCACATTGCAAAAGAGCACATGG - Intronic
1127485333 15:59413118-59413140 TCACGTGGCAAAGGGGGAGAAGG + Intronic
1127561026 15:60136116-60136138 CCACTGGGCCAAAGGCCAGAAGG + Intergenic
1127755614 15:62088979-62089001 TCACAGTGGCAAAGGGAAGAGGG + Intergenic
1127783783 15:62338728-62338750 TCACATGGCAGAAGAGCTGAAGG + Intergenic
1129360721 15:75022226-75022248 TCAAATGGGCAAAGGGAAGGCGG - Intergenic
1129693459 15:77726960-77726982 ACAAATGGCCAAAAAGCAGATGG + Intronic
1129935811 15:79449504-79449526 TCACATAACAAAAGGGCAAAAGG + Intronic
1130429611 15:83833357-83833379 TCACATGGCAGAAGGGATGAGGG + Intronic
1130546486 15:84860291-84860313 TGACATGGGCAAAGGGCACAAGG - Intronic
1130555488 15:84919574-84919596 TAACATGGTGGAAGGGCAGAAGG + Intronic
1131232179 15:90667250-90667272 TCACACAACCACAGGGCAGAGGG - Intergenic
1131975588 15:97942798-97942820 TCCCATGGCAAAAGGGGAAAGGG - Intergenic
1134102522 16:11462070-11462092 TAACCTGGCCACAGAGCAGAGGG + Intronic
1134166067 16:11930608-11930630 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134494651 16:14723119-14723141 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134500034 16:14762239-14762261 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134526577 16:14948857-14948879 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134545827 16:15107488-15107510 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134580546 16:15366811-15366833 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134714155 16:16347330-16347352 TCAGATGCCAGAAGGGCAGAGGG + Intergenic
1134722028 16:16390694-16390716 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1134945397 16:18321175-18321197 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1134952662 16:18361328-18361350 TCAGATGCCAGAAGGGCAGAGGG - Intergenic
1135266409 16:21030126-21030148 TCACATTGCAAAAGTGCATATGG - Intronic
1135311457 16:21408033-21408055 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1135364409 16:21840484-21840506 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1135420401 16:22302025-22302047 TCACATACCCAAAGAGAAGAGGG - Intronic
1135447434 16:22530864-22530886 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1135548619 16:23381565-23381587 TCACATGGTCCAAGGGCGGTGGG + Intergenic
1135626818 16:24002745-24002767 TCACATGGCCAAGGAGCATGCGG + Intronic
1136150616 16:28345931-28345953 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136166853 16:28459769-28459791 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136196122 16:28655263-28655285 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136212462 16:28769386-28769408 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136257183 16:29049298-29049320 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1136308163 16:29387029-29387051 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136321579 16:29488567-29488589 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136436259 16:30228537-30228559 TCAGATGCCAGAAGGGCAGAGGG - Intronic
1136658388 16:31729406-31729428 TAACATGGCCAAAGGCACGAGGG + Intronic
1136674505 16:31890708-31890730 TAACATGGCCAAAGGCCTGAGGG + Intronic
1137970202 16:52977125-52977147 TCAGATGGCCAAAGGGCTGGAGG - Intergenic
1138024476 16:53511888-53511910 ACACATGGACAGAGGGCAGCAGG + Intergenic
1138918567 16:61498709-61498731 TCACATGGTGGAAGGGCAGGTGG + Intergenic
1139083940 16:63561407-63561429 TCACATGCCCAAAGGTCTAAAGG - Intergenic
1139937933 16:70584595-70584617 TGACAAAGCCAAAGGGCAGCTGG - Intronic
1139990116 16:70933532-70933554 TCACATGGCCAGAAGGCGGTGGG - Intronic
1140178593 16:72690771-72690793 TCACTTGGCCAAAGGGACAAAGG + Intergenic
1140366874 16:74388633-74388655 TCAGATGCCAGAAGGGCAGAGGG + Intronic
1140601158 16:76476677-76476699 TCACATGGTGAAAGGGGTGAGGG + Intronic
1141345126 16:83237955-83237977 TCACATAGCCAGAAGGCAGAGGG + Intronic
1141464976 16:84199329-84199351 TCACATGTGCAAAGGACAGGAGG + Intergenic
1141572441 16:84942039-84942061 TCACTCAGCCCAAGGGCAGATGG - Intergenic
1144048316 17:11473461-11473483 TCACATGGCAGAAGAGTAGAAGG + Intronic
1144180419 17:12746375-12746397 TCCCATGGTAGAAGGGCAGAAGG + Intronic
1144183243 17:12772016-12772038 TAACCCAGCCAAAGGGCAGATGG + Intergenic
1148165594 17:45482162-45482184 AATCATGGCCTAAGGGCAGAGGG + Intronic
1149030110 17:52072923-52072945 TCACAGGCAAAAAGGGCAGAGGG + Intronic
1149124428 17:53210540-53210562 TCACATGACAAGAGGGCAAAAGG - Intergenic
1149963731 17:61140918-61140940 TCAAATGGACAAAGAGCACAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150396821 17:64828880-64828902 AATCATGGCCTAAGGGCAGAGGG + Intergenic
1150562302 17:66303675-66303697 GCAAATGGCACAAGGGCAGAGGG + Intronic
1150593639 17:66584729-66584751 TGACAGAGCCAAAGGGAAGAAGG - Intronic
1150645038 17:66972557-66972579 TTGCAGGGACAAAGGGCAGAGGG + Intronic
1151123398 17:71818348-71818370 TGGCAGGGCCATAGGGCAGAAGG - Intergenic
1151145454 17:72036338-72036360 TCACATGGCATAAGGGAAAAGGG + Intergenic
1151683105 17:75631956-75631978 TCCCATTGCCAGAGGACAGAGGG - Intronic
1151959834 17:77399874-77399896 TCACGTGGCCGCAGGGCAGCAGG - Intronic
1152019424 17:77772699-77772721 TCACATGGGATAAGGGGAGAGGG - Intergenic
1152694063 17:81735027-81735049 ACACATGGTCACAGGGCAGGAGG - Intergenic
1153016648 18:588464-588486 ACAAATGGCCAATGGGCATATGG - Intergenic
1154117328 18:11622653-11622675 TCAGATGCCAGAAGGGCAGAGGG - Intergenic
1154284987 18:13046183-13046205 TCACATGGCCAAAGCAGGGATGG + Intronic
1154338086 18:13481921-13481943 TCACAGGGCAGGAGGGCAGAGGG + Intronic
1155413073 18:25567319-25567341 TCACATGGCAGAAGGGGTGAAGG - Intergenic
1156496112 18:37526140-37526162 TCACATGGCCAGATGGTAGCAGG + Intronic
1156610655 18:38719977-38719999 TCACTAGGCCAAAGTGCAGTGGG - Intergenic
1156662709 18:39365930-39365952 TCACATGGCCAGGGAGGAGAAGG - Intergenic
1156706557 18:39889330-39889352 TCACAAGGCCAAAGGAAAGAAGG - Intergenic
1157423319 18:47563974-47563996 TCACATGGCAGAAGGGGTGAGGG - Intergenic
1157663575 18:49466773-49466795 TCACATGGAGGAAGGGCAGAGGG - Intergenic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1158902991 18:61983798-61983820 TCACATGGCGAAAGGGGTGAGGG + Intergenic
1158949277 18:62476886-62476908 TCACATGGCTGAAGAGCAGAAGG + Intergenic
1158949331 18:62477630-62477652 TCACATGACTGAAGAGCAGAAGG - Intergenic
1159243293 18:65771786-65771808 TTGCATGGCAAAAGGACAGAAGG - Intronic
1159284382 18:66329929-66329951 TCACATGGCCAAAGGAAGAAGGG - Intergenic
1160053807 18:75461123-75461145 TCACATGGCAAAAGGGGTGAAGG + Intergenic
1160147713 18:76378593-76378615 TCCCAGGGCCAACGTGCAGAGGG + Intronic
1160267189 18:77349105-77349127 ACACATGGACACAGGGCAGCAGG - Intergenic
1160856869 19:1221684-1221706 TCCCAAGGCCACTGGGCAGATGG - Intronic
1162306520 19:9877744-9877766 TCCCATGGCCAAAGGGCTGAAGG - Intronic
1163746530 19:19052107-19052129 GGGCATGGCCAAAGGGCACACGG - Exonic
1165302157 19:34977046-34977068 TCTCAAGTCCAAGGGGCAGAAGG - Intergenic
1165529391 19:36385246-36385268 TCTCATGGCGGAAGGGCAAAGGG - Intronic
1166534276 19:43562417-43562439 TCACATGCAAAAAGGGAAGATGG + Intronic
1167104766 19:47423771-47423793 ACACATGGCCAAAGGAGAGAGGG - Intergenic
1168304544 19:55428477-55428499 TCACATGCTCAGAGGACAGAGGG + Intergenic
925183220 2:1830451-1830473 TCACATGGCAGATGGGGAGATGG + Intronic
926489494 2:13506447-13506469 TCACATGGCAGAAGGGCAAAAGG + Intergenic
926882193 2:17558075-17558097 TTAGATAGACAAAGGGCAGAGGG + Intronic
927622673 2:24678073-24678095 ACACATGGACACATGGCAGAGGG - Intronic
928361377 2:30664780-30664802 TCACATGGCTGAAGGGGTGAGGG - Intergenic
928411751 2:31059749-31059771 TCACATGGCAGAAGGGGTGAGGG - Intronic
928415110 2:31085468-31085490 GCACAGGGCCACAGGGCAGGAGG + Intronic
928742937 2:34376981-34377003 TCACATGGTGAAAGGGCGGAAGG - Intergenic
929453497 2:42051287-42051309 GCCCAGGGCCAAAGGGCACAAGG + Intronic
929997905 2:46840515-46840537 GCAAAGGGCCAAAGGGGAGATGG - Intronic
931261674 2:60625362-60625384 TCACATGGCAGCAGGACAGAGGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931884123 2:66597529-66597551 TCACATGGCAGAAAAGCAGAAGG + Intergenic
931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG + Intergenic
932433905 2:71691965-71691987 GCACATGGGGAAAGGGGAGAGGG - Intergenic
932525612 2:72463961-72463983 TCACATGGCCACAAGGAACAAGG + Intronic
933286004 2:80385353-80385375 TCACATGGCCAAGGGGGCAAGGG - Intronic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
934569316 2:95358701-95358723 TCACATGGCTGAAGGGCACAGGG + Intronic
934791672 2:97067531-97067553 ACTCATGGCCAAAGGGGAGCAGG - Intergenic
935873926 2:107485709-107485731 TCACATGGCCAAAGAGGAAGAGG - Intergenic
936543131 2:113368282-113368304 TCACATGGCAGAAGGGGTGAGGG + Intergenic
937013605 2:118583556-118583578 TCACATGGCAGAAGGGGTGAGGG + Intergenic
937554304 2:123134165-123134187 TCACATGGTGAAAGGGAAGATGG + Intergenic
938118993 2:128620721-128620743 TCACATGGCAGAAGGGGTGAAGG - Intergenic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG + Intergenic
938340789 2:130534880-130534902 TCACTTGGCAAAAGGGGTGAGGG - Intergenic
938349041 2:130585829-130585851 TCACTTGGCAAAAGGGGTGAGGG + Intergenic
938730386 2:134142598-134142620 TCACATGACCAAAGGGCACTGGG + Intronic
939499371 2:142963500-142963522 TCACATGGCAGAAGGGCTAAGGG + Intronic
940619219 2:156089721-156089743 TCACATGGCAGAAGGGCCAAAGG - Intergenic
941462618 2:165789277-165789299 TCACATGGAGGAAGGGCAAAAGG + Intronic
941529598 2:166650424-166650446 TCACATGGCAGAAGGGAGGAAGG - Intergenic
942205567 2:173617134-173617156 TCTCATGGCAGAAGGGCAGAAGG + Intergenic
942256975 2:174112721-174112743 TCCCATGGCAGAAGAGCAGAAGG - Intronic
942471604 2:176266694-176266716 TCACATGGCAGAAGGGCAAAAGG - Intergenic
943324860 2:186486047-186486069 TCAGATGGCAAAAGGCCTGAGGG - Intergenic
943862396 2:192884529-192884551 TCTCATGGCAGAAGGACAGAAGG + Intergenic
944127061 2:196306118-196306140 TCATATGGTCTAAGGGCGGAGGG - Intronic
944605950 2:201351399-201351421 GTACATGGCCAAAGGTCAGGGGG + Exonic
945319502 2:208405838-208405860 TCACATGGCAGAAGGGATGAGGG - Intronic
945937810 2:215921069-215921091 ACACACGGACACAGGGCAGAGGG + Intergenic
946545900 2:220743042-220743064 TCACAAGGTCAAATGGCAGATGG + Intergenic
947029480 2:225776773-225776795 TCACATAGCCAAAAGGCTAAGGG - Intergenic
947163491 2:227238003-227238025 TGACGGGGCCAAAGGGGAGAAGG + Exonic
947249706 2:228088751-228088773 TCACATGGCAAGAGAGAAGAGGG - Intronic
948462638 2:238137764-238137786 CCACATGGCCGATGGGTAGAGGG + Intergenic
948592243 2:239058553-239058575 AAACCTGGCCAAAGGGCAGCTGG + Intronic
948792601 2:240386680-240386702 TCACAGAGGCAGAGGGCAGACGG + Intergenic
1169292821 20:4367268-4367290 TCACATGTTCAGAGAGCAGAGGG - Intergenic
1169551529 20:6706446-6706468 GGAGATGACCAAAGGGCAGAAGG + Intergenic
1169951266 20:11046105-11046127 TCACATGGCACATGGGAAGAAGG + Intergenic
1169977645 20:11348119-11348141 TCACATGGCCAAGGAGAACACGG + Intergenic
1170676322 20:18484495-18484517 TCACATGGCAGAAGGGGTGATGG - Exonic
1170957050 20:20991168-20991190 TCACATGGCAGAAGGGGAGAGGG + Intergenic
1171259625 20:23720628-23720650 TCAAATGGCCACAGTGCAGAAGG + Intergenic
1171268692 20:23796088-23796110 TCAAATGGCCACAGTGCAGAAGG + Intergenic
1171458274 20:25283924-25283946 TCTCATGGGAAAAGGGGAGAGGG - Intronic
1171536411 20:25896574-25896596 TCACATGGCATAAGGGAAAAAGG + Intergenic
1171804692 20:29664584-29664606 TCACATGGCATAAGGGCAAAAGG - Intergenic
1171839361 20:30191842-30191864 TCACATGGCATAAGGGCAAAAGG + Intergenic
1171998579 20:31753216-31753238 TCACAAGGTAAGAGGGCAGAAGG + Intronic
1172012580 20:31854468-31854490 TGACGTGGGCACAGGGCAGAGGG + Intronic
1172049282 20:32104014-32104036 TCACATGTCCACAGGTCAGATGG - Intergenic
1172318623 20:33977766-33977788 TCCCATGGTGGAAGGGCAGAAGG + Intergenic
1172500898 20:35426389-35426411 TCCCATGGGCAAAGGGCAGAAGG - Intergenic
1172852918 20:37979510-37979532 TCACATGCCCAAAGAGCTGTGGG - Intergenic
1173308586 20:41875295-41875317 TCAGATGGGCCAAGGGGAGATGG - Intergenic
1173314884 20:41934110-41934132 TCACATGGCCCATGCACAGAGGG - Intergenic
1173788346 20:45811574-45811596 ACAAATGGGCAAAGGGAAGACGG - Intergenic
1174517765 20:51106295-51106317 TCACATGGCAGAAGGGGAAAGGG - Intergenic
1176582656 21:8545695-8545717 TCACATGGCATAAGGGCAAAAGG - Intergenic
1178622630 21:34189794-34189816 TCACAAGGCCACAAGGCAGCAGG - Intergenic
1179341896 21:40519487-40519509 TCAGATGGCCAAAGGGGCAAGGG - Intronic
1179745236 21:43440659-43440681 TCACCTGGACTAAGGGCAGGAGG + Intergenic
1180265488 22:10522743-10522765 TCACATGGCATAAGGGCAAAAGG - Intergenic
1181385567 22:22543057-22543079 TCACATGGCAGAAGGGTGGAAGG - Intergenic
1181431889 22:22886818-22886840 TCACAGGGCCAAGAGGCAGTAGG - Intronic
1182080667 22:27526596-27526618 ACTCATGGCCAGCGGGCAGAAGG + Intergenic
1182362396 22:29754386-29754408 TCTCTTGGCCAAGGGGCAGCGGG + Intronic
1183261036 22:36796164-36796186 TCACATGGTGAAAGGGCAAAGGG + Intergenic
1183283603 22:36948332-36948354 TCATATGGCCGAAGGGGCGAGGG + Intergenic
1183449162 22:37881733-37881755 GCAAATGTCCATAGGGCAGAGGG + Intronic
1183680597 22:39326802-39326824 TCACATACCTGAAGGGCAGATGG + Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
949603267 3:5624947-5624969 TCAAATGGCAAAAGGGATGAGGG - Intergenic
950030251 3:9847311-9847333 TCACATGGCGGAAGGGGCGAGGG - Intronic
950507300 3:13403351-13403373 TCACATGGCAGAAGGGGCGAGGG + Intronic
951035474 3:17927525-17927547 TCGCATGGCAAAGGGACAGAAGG - Intronic
951857155 3:27210286-27210308 TCACACGGCAAAGGGGCTGAGGG + Intronic
951985263 3:28612794-28612816 TCCCATGGCAGAAGGACAGAAGG + Intergenic
952665091 3:35894696-35894718 TCATATGGCTAGAGGTCAGAAGG + Intergenic
953403176 3:42644749-42644771 TCAAGTGGCAAAAGGGGAGATGG - Intronic
953408562 3:42673507-42673529 TCACATGGCAGAAGGCCAAAGGG + Intergenic
955184182 3:56699359-56699381 TCACATGGCTAAAGGGGTAAAGG - Intergenic
955241649 3:57183242-57183264 TCACATGGCAGAAGGGGAAAGGG + Intergenic
955671482 3:61407619-61407641 TCTGATGACCCAAGGGCAGAAGG - Intergenic
956085600 3:65606195-65606217 TCACAAAGCCAGAGGACAGAAGG + Intronic
956764599 3:72473800-72473822 TCACATGGCAGAAAAGCAGAAGG - Intergenic
958670938 3:97203051-97203073 TCACATTGTCAGAGGGCAGTTGG - Intronic
959064951 3:101646852-101646874 TCACATGGCACAAGGCCATAAGG + Intergenic
959138144 3:102451043-102451065 TTTCATGGCCAAAAGGCAAACGG - Intronic
959181074 3:102980867-102980889 ACAAATGGCCAAAGGGTATATGG + Intergenic
959501330 3:107108862-107108884 TCACATGGCAAAAGGTGGGAGGG + Intergenic
959508974 3:107188660-107188682 TCACATGGTAGAAGGGGAGAGGG + Intergenic
960270418 3:115667962-115667984 TGACATGCTCAAAGGACAGAAGG - Intronic
960507103 3:118506994-118507016 TCACATAGGGAAAGGGCATATGG + Intergenic
961385065 3:126518543-126518565 GGACATGGCCAAAGGCCACAGGG - Intergenic
961589275 3:127963547-127963569 TCACATGGACAAAGTGAAGCTGG + Intronic
962282484 3:134062495-134062517 TCCCATGGCAGAAGGGCAGAAGG + Intergenic
962327503 3:134447917-134447939 TCACAAGGACATTGGGCAGAAGG + Intergenic
962663138 3:137625649-137625671 TCACATGGTGGAATGGCAGAAGG - Intergenic
963762807 3:149301293-149301315 TCACAGGGATAGAGGGCAGACGG - Intergenic
963908423 3:150793766-150793788 TCACATGGTAGAAGGGCAGAGGG - Intergenic
964320570 3:155492319-155492341 GCACATGGCCAAGGAGCAGGTGG + Intronic
964441852 3:156719390-156719412 TCACATGGCAGAAGGGAAGAGGG - Intergenic
964642000 3:158918348-158918370 ACACTTAGCCACAGGGCAGAGGG - Intergenic
965767098 3:172142374-172142396 TAACAAGCCTAAAGGGCAGAAGG - Intronic
966730881 3:183150463-183150485 TCACATGGGCAGTGGGCAGTGGG + Intronic
966888947 3:184392421-184392443 TGAAATTGCCACAGGGCAGAGGG + Intronic
967260700 3:187638929-187638951 TCACATGGCAAAAGGGAAGAAGG + Intergenic
967292393 3:187933983-187934005 TCAAATGGACAAAGGGCTCACGG + Intergenic
969248804 4:5953959-5953981 GCACTTGGTCCAAGGGCAGAAGG - Intronic
969855593 4:9996642-9996664 TCAAATGCCCAAAGGGGAAAGGG - Intronic
970694995 4:18666727-18666749 TCACATGGTGAAGGGGCAGAAGG + Intergenic
971892368 4:32541728-32541750 TCACATGGCTAAAGGGGATGAGG - Intergenic
972161574 4:36234301-36234323 TCACATGGCAGAAGGGCAAGGGG + Intronic
972505927 4:39719977-39719999 TCACAGTGCCTATGGGCAGATGG - Intronic
972907343 4:43767497-43767519 TCACATGGCAGGAAGGCAGAGGG + Intergenic
974345819 4:60679712-60679734 TCACATGGCAAAAGGGAAAAAGG - Intergenic
974598771 4:64048330-64048352 TCACATGGTCAAAGGGTGGTGGG - Intergenic
974837288 4:67266235-67266257 TCAGGTGGCAGAAGGGCAGAAGG + Intergenic
975516292 4:75251973-75251995 TCACATGGCAAAATGTCAAAGGG - Intergenic
975965078 4:79963567-79963589 AGCAATGGCCAAAGGGCAGATGG - Intronic
976224888 4:82788088-82788110 TCACATGGCAAAAGGGGTGAAGG - Intronic
976236126 4:82899600-82899622 TCACATGGCCTAAGGATAGATGG - Intronic
977127364 4:93187007-93187029 TCACATGGTGCAAGGGCAAAAGG + Intronic
978964442 4:114724596-114724618 TCACATGGCAGAAGGGAGGAGGG - Intergenic
979841294 4:125444290-125444312 TTTCATGGCAGAAGGGCAGAAGG + Intronic
980174843 4:129332201-129332223 TCACATGGCAGAAGGGGTGAGGG - Intergenic
980502701 4:133677140-133677162 TCACATAGCTGAAGGGCAAAAGG + Intergenic
980754962 4:137147021-137147043 TCACATGGCAAAAGGGGTGAGGG + Intergenic
981422160 4:144563585-144563607 TCACATGGCAGAAGGACAAAAGG + Intergenic
983118642 4:163851815-163851837 GCACATGGCCACAGGGGAAATGG - Intronic
985007075 4:185544620-185544642 TCACATGGCAGAAGGAGAGAAGG + Intergenic
985318034 4:188679147-188679169 TCACATGGCAGAAGAGTAGAAGG - Intergenic
985749577 5:1666713-1666735 ACACATGGCCAAAAAGCATATGG - Intergenic
986268353 5:6210074-6210096 TCACATGGTCGAAGAGCTGAGGG + Intergenic
986536973 5:8798109-8798131 TCTCCTTGACAAAGGGCAGAAGG + Intergenic
986867979 5:12012573-12012595 TCACATGGTGGAAGGGAAGAGGG - Intergenic
987081049 5:14425758-14425780 TCACATGGCGGAAGGACAAAAGG - Intronic
987090686 5:14505848-14505870 TCTCATGGCAGAAGGGCAGACGG + Intronic
987941353 5:24542793-24542815 TCACATGGCAGAAGGGCAAAAGG + Intronic
988089451 5:26517355-26517377 GCAAAGGGCAAAAGGGCAGAAGG + Intergenic
988412648 5:30907163-30907185 TCAAATGGCAGAAGGGCAAAAGG + Intergenic
988545763 5:32156095-32156117 TCACATGGCAGAAGGGCATAGGG - Intronic
989624152 5:43413605-43413627 TCACCTGGCAGAAGAGCAGAAGG - Intergenic
989826490 5:45863045-45863067 TAACATGACCAATGGTCAGATGG - Intergenic
991292945 5:65050449-65050471 TTACATGGCAAAAGGGGTGAGGG + Intergenic
993121403 5:83779198-83779220 TCCCATGGTGGAAGGGCAGAGGG + Intergenic
993598360 5:89888300-89888322 TCACACGGCCAAAAAGCAGGTGG - Intergenic
993701419 5:91123430-91123452 TCACATGGCAGAAGAGCAAAGGG + Intronic
994739340 5:103598390-103598412 TCACATGGAAAATTGGCAGAGGG - Intergenic
995058379 5:107787576-107787598 TCACATGGCGAAAGGGGCAAGGG - Intergenic
995755487 5:115499198-115499220 TCACATGGCAGAAGGGGTGAGGG + Intergenic
995765048 5:115605268-115605290 TCTCAGAGCCAAAGGGTAGAAGG + Intronic
996179741 5:120404822-120404844 TCCCGTGGCAAAAGAGCAGAAGG + Intergenic
996338756 5:122413097-122413119 TCAGATGGCAGAAGGGGAGAGGG - Intronic
996728819 5:126697572-126697594 CCACATGGCAGAAGGGCAAAAGG + Intergenic
997040202 5:130243907-130243929 TCACAAGGCTCCAGGGCAGAGGG + Intergenic
997841173 5:137241664-137241686 TCCCATGGCTGAAGGGCAAAAGG - Intronic
998211602 5:140203480-140203502 TCACATTGCAAAAAGGCATATGG + Intronic
1000388900 5:160702062-160702084 TCACAAGGCAATAGGGTAGAGGG - Intronic
1000578827 5:163010253-163010275 TCACATGGCACAAGGGCAAAAGG + Intergenic
1000580780 5:163033469-163033491 TCACATGGAGAGAGGGCTGAGGG - Intergenic
1000701708 5:164458869-164458891 TCACATGGCAGAAGGGCAAAAGG - Intergenic
1000711615 5:164586763-164586785 TCACAGGGCCAATGGGAAGTGGG + Intergenic
1000840646 5:166213653-166213675 TCTCATGGTGAGAGGGCAGAAGG + Intergenic
1002119398 5:176990297-176990319 TCACATGGCAGAAGGGTAAAAGG - Intronic
1002306530 5:178286912-178286934 TCACAGGTCCAGAGGGGAGAGGG - Intronic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1003986252 6:11437990-11438012 TCACAGGGCCAATGGAAAGAAGG - Intergenic
1006406501 6:33848757-33848779 ACAAATGGCCAGATGGCAGAGGG - Intergenic
1007076126 6:39067462-39067484 TCACATGGCAGAGGGGCAAATGG + Intronic
1007241573 6:40430405-40430427 TCACACAGCCAAAGGGCCCATGG - Intronic
1007496015 6:42260791-42260813 TCACATGGCCTGGAGGCAGATGG - Intronic
1008189157 6:48433106-48433128 TTACATGGCCACAGGAAAGAAGG + Intergenic
1009031249 6:58060893-58060915 TCACATTGCAAAAGAGCAGGTGG - Intergenic
1009207106 6:60815355-60815377 TCACATTGCAAAAGAGCAGGTGG - Intergenic
1010496975 6:76545797-76545819 TCACATGGCAAAAGGGGCAAAGG - Intergenic
1010875702 6:81102800-81102822 TCACATGACGAAAGGCCATAAGG - Intergenic
1011571195 6:88737657-88737679 TCACATGGCACAAGGGGAGGAGG - Intronic
1012874723 6:104712812-104712834 TTACATGGCAGAAGAGCAGAAGG - Intergenic
1013090889 6:106899985-106900007 TCACATGGACAAAGGGGCAAGGG + Intergenic
1014525102 6:122493283-122493305 TCACATGGTGAAAGGGACGAAGG - Intronic
1015429462 6:133113395-133113417 TTACATGGCAGAAGGGAAGAAGG - Intergenic
1015804156 6:137091811-137091833 TCACATGGCAAGAGGGGAGCAGG - Intergenic
1016630777 6:146228330-146228352 TCCCATGGCAGAAGAGCAGAAGG + Intronic
1017155045 6:151315342-151315364 TCATGTGGCAGAAGGGCAGAGGG + Intronic
1017639403 6:156476504-156476526 TCACATGGCTAAAGGCGAAAGGG - Intergenic
1017785164 6:157750836-157750858 GCAAATGGCCAACGGGCATATGG + Intronic
1017805433 6:157941634-157941656 TCCCATGGCCAGAGGGGAGCTGG - Intronic
1017985778 6:159442061-159442083 TCACATGTCAAAAGGGCATCGGG + Intergenic
1018580411 6:165303094-165303116 TGTGATGGCCAAAGGGCAGCAGG + Intronic
1018661438 6:166090781-166090803 TCACATGGCGAAAGGGGAAGAGG + Intergenic
1018677581 6:166236165-166236187 TTCCATGGCCACAGGACAGAAGG + Intergenic
1018914245 6:168123061-168123083 TCACATGGCAGCAGGGAAGAGGG - Intergenic
1019075171 6:169380959-169380981 TCACATGGCAAGTGTGCAGACGG + Intergenic
1020115079 7:5471702-5471724 CCACATGGACAAAGGCCAGGCGG + Intronic
1020120121 7:5498418-5498440 CCACATGGACAAAGGCCAGGGGG + Intronic
1021260513 7:18451161-18451183 TCACATGATGAAAGGGCAAAGGG - Intronic
1022680406 7:32540005-32540027 TTACTTGGCAAAAGGGCAAAAGG - Intronic
1023016398 7:35971772-35971794 TCACGGGGACAAAGGGCAGGCGG - Intergenic
1023657216 7:42435946-42435968 ACACATGGCCAACGAGCATACGG - Intergenic
1023959088 7:44912069-44912091 TCACAAGGCCAGGAGGCAGATGG + Intergenic
1024240592 7:47432331-47432353 TCACATGGCGAGGGGGCTGAGGG - Intronic
1024253485 7:47523168-47523190 TCACATAGCCAAAGGTGTGAGGG + Intronic
1024550203 7:50556340-50556362 TCACATGGTGAAAGGGGTGATGG + Intronic
1025287882 7:57683280-57683302 TCACATGGCATAAGGGCAAAAGG + Intergenic
1026507352 7:70996290-70996312 TCACATGGTAGAAGAGCAGAAGG + Intergenic
1027301072 7:76836421-76836443 TCACATGGTGAAAGGGATGAAGG + Intergenic
1027307670 7:76918351-76918373 TCACATGGTCAAAGGGGTGAGGG + Intergenic
1027869655 7:83691118-83691140 TCACAGGACCAAGGGGAAGAGGG + Intergenic
1028230077 7:88296598-88296620 TCACAAGGCAAAAGGGCAGGAGG + Intronic
1029236530 7:99124346-99124368 TAAAAAGGCCAAAGGGCAGAAGG + Intronic
1029605890 7:101599205-101599227 TCACATGCCAAGAGGGCAGAGGG - Intergenic
1031537705 7:122955812-122955834 TCCCCTGGCCAAAAGGCAGGAGG - Intergenic
1032293529 7:130613114-130613136 TCCCATGGACAGAGGGCAGAGGG + Intronic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1033832727 7:145272826-145272848 TCACATGGCAGAAGGGGAGAAGG - Intergenic
1033844123 7:145411880-145411902 TTACATGGCCACAGGCAAGAGGG + Intergenic
1034930159 7:155155110-155155132 TCACATGGCAGAAGGGATGAGGG - Intergenic
1036119412 8:5999515-5999537 TCACATGGCAAAAGGGGTGAGGG - Intergenic
1036180666 8:6581880-6581902 TCACATGGCAGAAGGGGTGAGGG + Intronic
1036181452 8:6588800-6588822 TGACCTGGCCCAAGGGCAGCTGG - Intronic
1036673522 8:10810016-10810038 TCACATGGCCAGATGGCAGGAGG + Intronic
1037702442 8:21287359-21287381 TCACATGACAAAAGGTGAGAGGG - Intergenic
1037893130 8:22634644-22634666 TCAAAGGGCCACAGGGCAGTGGG - Intronic
1038257300 8:25961987-25962009 TCAGTTGGGCAAAGGGTAGAAGG - Intronic
1039005446 8:33031551-33031573 ACACATGGACACAGGGCACAGGG + Intergenic
1039415742 8:37392604-37392626 TCACAGGGCCAAAGGGACGCTGG - Intergenic
1040611271 8:48984478-48984500 GCCCAGGGCCAAAGGACAGAGGG + Intergenic
1041821428 8:62038722-62038744 CCACATGGCAAAAAGGCACATGG - Intergenic
1041903494 8:63007740-63007762 TCACCTGGCCAAGGCACAGAAGG + Intergenic
1041973777 8:63773809-63773831 TCACATGGCAGAAGGGGTGATGG + Intergenic
1042058781 8:64794561-64794583 TCACATGGACAAAGGGGCAAGGG + Intronic
1042074675 8:64978864-64978886 TGACAAGACCTAAGGGCAGAGGG - Intergenic
1042102065 8:65284561-65284583 TCAAATGCACAAAGGGAAGAGGG - Intergenic
1042929662 8:74000844-74000866 TCCCATGGCAGAAGGGCAGAAGG + Intronic
1043021073 8:75000515-75000537 TCACATCTGCAAAGGGCAGCAGG - Intronic
1043480319 8:80646013-80646035 TCACATGGCAGAAGGTGAGAGGG - Intronic
1044537487 8:93374208-93374230 TCACATGGCAGAAGGGCTGAGGG + Intergenic
1044839337 8:96324550-96324572 TCCCATGGTGGAAGGGCAGAAGG + Intronic
1044846085 8:96383259-96383281 TCACAGTGCCATAGGTCAGAAGG + Intergenic
1045408364 8:101890596-101890618 CAACATGGCAGAAGGGCAGAGGG - Intronic
1045683146 8:104683858-104683880 TCACATGGCAGAAGGACAAAAGG + Intronic
1046065007 8:109185846-109185868 TCACATGGCAGAAGACCAGAAGG - Intergenic
1046783107 8:118236912-118236934 TGAGAAGACCAAAGGGCAGAAGG + Intronic
1046983354 8:120360862-120360884 TGACCTTGCCAAAGAGCAGAGGG - Intronic
1048160438 8:132015951-132015973 ACAAATGGCCAAAGAGCACATGG - Intergenic
1048755311 8:137731859-137731881 TCACTCAGCAAAAGGGCAGAAGG - Intergenic
1049471235 8:142775882-142775904 TAAGATGGACAAAGGACAGAGGG - Intronic
1050769298 9:9176746-9176768 TCCCATGGCAGAAGGGAAGAAGG - Intronic
1051481238 9:17563720-17563742 TCACATGGTGGAAGAGCAGAAGG - Intergenic
1051602085 9:18885521-18885543 TCACATGGCCAAAGCCAAGAGGG + Intronic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1053097265 9:35339450-35339472 CCACATGGCCAAAGGACATCAGG - Intronic
1055669536 9:78588947-78588969 TCACATGGCAGAAGGCAAGAAGG - Intergenic
1055753307 9:79530584-79530606 TCACATGGGGAAGGGGCAGAGGG + Intergenic
1055841631 9:80512364-80512386 TCACAGGGCCAATGGGAAGGGGG - Intergenic
1055945247 9:81687684-81687706 TCACCAGGCCAAAGGGAAGGGGG + Intronic
1055957086 9:81784480-81784502 TCACTAGGGCAAGGGGCAGAGGG - Intergenic
1057009024 9:91585111-91585133 TCACAGAGCCAAATGCCAGATGG - Intronic
1057169825 9:92955042-92955064 TCAGGTGGCCAAGGAGCAGAGGG + Intronic
1057365251 9:94414450-94414472 TCACATGCTCAAAGGCCTGAGGG - Intronic
1057565992 9:96166764-96166786 TCACATGGCTGAAGGGGTGAGGG - Intergenic
1057658071 9:96973634-96973656 TCACATGCTCAAAGGCCTGAGGG + Intronic
1057857064 9:98609922-98609944 CCACAAGCCAAAAGGGCAGAGGG + Intronic
1059356120 9:113700829-113700851 TCACATTGCAAAAGAGCAGATGG - Intergenic
1059919006 9:119136837-119136859 TCACATGGTGGAAGAGCAGAAGG - Intergenic
1060153480 9:121303132-121303154 TCACAAGGCCAAAAGATAGATGG - Intronic
1060250465 9:121982857-121982879 TCAGATAGACAAGGGGCAGATGG + Intronic
1061363142 9:130156540-130156562 TGTCATTGCCAAAGGGCAGCTGG + Intergenic
1061942352 9:133890541-133890563 TCTCATGGACAAAGGGGAGAGGG - Intronic
1062114685 9:134802048-134802070 TCACTTGCCCACAGGGAAGAGGG + Intronic
1062673830 9:137728087-137728109 TTACAGGGCTAAAGGCCAGAAGG - Intronic
1203612676 Un_KI270749v1:23703-23725 TCACATGGCATAAGGGCAAAAGG - Intergenic
1185687034 X:1937755-1937777 TCCCATGGCAGAGGGGCAGAAGG + Intergenic
1186031032 X:5369200-5369222 TCACATGGTGAAAGGGGCGAGGG - Intergenic
1186178794 X:6952742-6952764 TCACATGGTGGAAGGGCAAAAGG - Intergenic
1186312499 X:8335898-8335920 TGAGATGGCCAAAGAGCAAAGGG - Intergenic
1186610229 X:11131592-11131614 TCACATGGCAGAAGGGGCGAAGG + Intergenic
1186687765 X:11943487-11943509 TCCCATGGCGGAAGAGCAGAAGG + Intergenic
1186824456 X:13325106-13325128 TCAGATGGCCTAAGATCAGATGG - Intergenic
1187563346 X:20423371-20423393 TCACATGGTGAAAGGGGTGAAGG - Intergenic
1187802788 X:23082668-23082690 TCACATGGCAAAAGGGGTAAGGG + Intergenic
1187802791 X:23082716-23082738 TCACATAGCAGAAGAGCAGAAGG + Intergenic
1188430452 X:30101031-30101053 TCCTATGGCAAAAGGGCAGAAGG - Intergenic
1188507557 X:30898930-30898952 TCACATGGCAGAAGAGCAGAAGG - Intronic
1188911191 X:35849542-35849564 TCACATGGCAAAAGGTAAAAGGG - Intergenic
1189419440 X:40843579-40843601 TCAAAAGGATAAAGGGCAGAGGG + Intergenic
1189601689 X:42633522-42633544 TCACATGGCCAAAGGTGAAAGGG - Intergenic
1189986023 X:46553904-46553926 GAACTTGGCCAAGGGGCAGAAGG + Intergenic
1190444105 X:50505772-50505794 TCAGAGGCCCAAAGGGTAGAGGG + Intergenic
1191720000 X:64221522-64221544 TCACATGGTGAAAGGGGTGAGGG + Intergenic
1192272652 X:69597293-69597315 TCACATGGCAGAAGGGCAAAAGG + Intergenic
1192430147 X:71106297-71106319 ACTAATGGCCAAAGGTCAGAAGG - Intronic
1192439982 X:71167207-71167229 TCACAGGGCCAAAGGCCACGTGG - Exonic
1192671135 X:73143100-73143122 CCACCTGGGCAAAGGGCTGATGG - Intergenic
1193577571 X:83220785-83220807 TCACATGGCCAAAGGGGCAAAGG + Intergenic
1194461891 X:94180424-94180446 TCACATGGTGAAAGAGCAAAAGG - Intergenic
1194637608 X:96364559-96364581 TCACATGGCGAAAGAGGAGGAGG - Intergenic
1195139565 X:101945646-101945668 TCACATGCCAGAAGGGCAAAAGG - Intergenic
1195798462 X:108680177-108680199 TCAAATGGCCAATGGGCAGGGGG + Intronic
1196327154 X:114420027-114420049 TCACATGGTAGAAGGGCAAAGGG - Intergenic
1196412870 X:115438532-115438554 TCCCATGGCAGAAGGACAGAAGG - Intergenic
1196760450 X:119196418-119196440 TCACATGGCAGAAGGGTAAAAGG + Intergenic
1197115281 X:122824837-122824859 TCACATGGTGAAAGGGATGAGGG + Intergenic
1197377617 X:125701014-125701036 TAACATTGCCAAAGACCAGATGG + Intergenic
1197848503 X:130831025-130831047 TAACACGGCTGAAGGGCAGAAGG + Intronic
1197871552 X:131067167-131067189 TCACAAGGCCCAAGGGGAAAGGG + Intronic
1198087016 X:133291481-133291503 TCCCATGGTGGAAGGGCAGAAGG + Intergenic
1199117787 X:144012879-144012901 TCACATGGCTGAAGGCAAGAAGG - Intergenic
1199146501 X:144375423-144375445 TCACATAGTGAAAGGGGAGAGGG + Intergenic
1199424876 X:147689666-147689688 TCACATGGTCAAAGGGACAAGGG - Intergenic
1200032340 X:153306844-153306866 TCACATGGGCAAAGGCCAGAAGG - Intergenic
1200448375 Y:3293615-3293637 TCACATGGCCATTGGGCATGTGG - Intergenic
1201512510 Y:14780641-14780663 TCACATGGTAAAAGGGATGAGGG - Intronic