ID: 1184471155

View in Genome Browser
Species Human (GRCh38)
Location 22:44697243-44697265
Sequence TACCCTGGGCTCCCCCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184471146_1184471155 20 Left 1184471146 22:44697200-44697222 CCAGGTCCGGTGGCCTGGTGCTT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
1184471150_1184471155 7 Left 1184471150 22:44697213-44697235 CCTGGTGCTTGGTGCCGGAGTCA 0: 1
1: 0
2: 1
3: 2
4: 109
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
1184471143_1184471155 29 Left 1184471143 22:44697191-44697213 CCAAGGCCACCAGGTCCGGTGGC No data
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
1184471151_1184471155 -7 Left 1184471151 22:44697227-44697249 CCGGAGTCACCGCGAGTACCCTG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
1184471145_1184471155 23 Left 1184471145 22:44697197-44697219 CCACCAGGTCCGGTGGCCTGGTG No data
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175
1184471148_1184471155 14 Left 1184471148 22:44697206-44697228 CCGGTGGCCTGGTGCTTGGTGCC 0: 1
1: 0
2: 1
3: 24
4: 223
Right 1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG 0: 1
1: 0
2: 0
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184471155 Original CRISPR TACCCTGGGCTCCCCCAGCG TGG Intronic
900431709 1:2605876-2605898 CACCCGCGGCTCCCCCAGAGTGG + Intronic
900545506 1:3226789-3226811 TTCCCTGGGGTCCCCGTGCGGGG - Intronic
901535714 1:9881834-9881856 TACCTTGTGCTCCCCAAGCCTGG - Intronic
902521581 1:17020842-17020864 GCCTGTGGGCTCCCCCAGCGAGG + Intronic
902589102 1:17460705-17460727 TTCCCAGGGCTCCTCCAGGGTGG + Intergenic
902623050 1:17661534-17661556 TACCCTAGGCTTCCACAGCGAGG + Intronic
902796695 1:18805028-18805050 GGCCCTGGGGTCCCCCAGAGAGG - Intergenic
912386960 1:109275781-109275803 TACCCTGTCCTCCCACAGGGAGG + Intergenic
913267455 1:117059432-117059454 TTCTCTAGGCTCGCCCAGCGTGG - Intergenic
913300810 1:117367195-117367217 TACCCCGGGCTCTCGGAGCGTGG + Intergenic
915107730 1:153544921-153544943 TGCTCTGGGCTCCCCCAGGGAGG - Intronic
915544107 1:156586229-156586251 TACCCTGGGCTTCCAGAGCCGGG - Intronic
915585114 1:156840269-156840291 TGCCCAGGGCTCCCCAAGCTTGG - Exonic
915785445 1:158606690-158606712 TAGCCTGGTCCCCCCCAGCCAGG - Exonic
916259122 1:162822848-162822870 TTCCCTGAGCTCCCCGAGCTGGG - Intergenic
922178224 1:223213591-223213613 TACCATGGTCTCTCCCCGCGAGG - Intergenic
1065186517 10:23174573-23174595 CACCCTGCCCTCCCCCAGCCCGG - Intergenic
1067523686 10:47026204-47026226 TACCCTAGGCTCACACAGCTGGG - Intergenic
1068544106 10:58327170-58327192 TTCCCTGGCCTCCCGGAGCGGGG + Intergenic
1070667920 10:78358560-78358582 TCCCCTGGGCACCCGCAGCAAGG + Intergenic
1072782634 10:98260947-98260969 GATGCTGGGCTTCCCCAGCGAGG - Exonic
1074923657 10:118046317-118046339 GCCCCTGGGCTGCCCCCGCGAGG - Exonic
1075697409 10:124447349-124447371 TGCCCTCGGCTCCTCCACCGGGG - Exonic
1076424427 10:130357414-130357436 TCCCTTTGGCTCCCCCAGCATGG + Intergenic
1076485013 10:130810293-130810315 TGCCCTTGGTTCCCGCAGCGGGG - Intergenic
1076726520 10:132416587-132416609 CACCCTGGGATCCCCATGCGTGG + Intronic
1076738544 10:132469346-132469368 TGACCAGGGCTGCCCCAGCGAGG + Intergenic
1077510705 11:2960312-2960334 GACCCTGGCTTCCCCCAGCAGGG - Intronic
1078147319 11:8730662-8730684 CAGCCTGGGCTGTCCCAGCGTGG - Exonic
1078571112 11:12458685-12458707 CACCCTGGGCTGCCACAGAGGGG - Intronic
1080679554 11:34461401-34461423 GACGTTGGGCTCCCCCTGCGTGG + Intronic
1083265326 11:61544209-61544231 TCCCCTGGGCTGCCCAAGGGAGG + Intronic
1083476779 11:62920503-62920525 TATCTTGGGCTCCCGCAGGGTGG - Intronic
1083895160 11:65616180-65616202 CGCCATGGCCTCCCCCAGCGGGG - Exonic
1088554633 11:111049197-111049219 TATTCTGGGCTCACCCAGTGTGG - Intergenic
1089302522 11:117507319-117507341 TACCCTGGGCCCATCCAGAGTGG + Intronic
1089344291 11:117780691-117780713 GGCCGCGGGCTCCCCCAGCGCGG - Exonic
1089811686 11:121137488-121137510 TACCCTGGGCCCCATCTGCGTGG + Exonic
1093182964 12:15988144-15988166 AACTCAGGGCTCCCCCAGCTAGG - Intronic
1095964758 12:47859137-47859159 AATCTTGGGCTCCCCAAGCGAGG - Intronic
1096417195 12:51424728-51424750 TACCCTGGGCTACCGCGGGGAGG - Intronic
1096746153 12:53728181-53728203 TGGACTGGGCTCCCCCAGAGTGG + Intergenic
1096818191 12:54214968-54214990 GACTCGGGGCTCCCACAGCGGGG + Intergenic
1097679135 12:62632589-62632611 TACCCGGGGCTCCCCCGGGCAGG - Intergenic
1102045847 12:109829744-109829766 TTCCCTGAGCTCCTCCAGCGGGG + Intronic
1102555340 12:113723134-113723156 TACCTTGGGCTCCCAAAGCTTGG + Intergenic
1102814493 12:115853369-115853391 CACCCTGAGCTTCCCCAGAGAGG - Intergenic
1103532248 12:121610574-121610596 TTCCCTTGCCTCCCCCAGCCTGG - Intergenic
1104859246 12:131916138-131916160 CATCCTGGGCTCCCCCACCAAGG + Exonic
1105862981 13:24433297-24433319 TACCGTGGGCTCCCAGAGCTCGG + Intronic
1105957980 13:25301803-25301825 GACTCTGGGCTCCACCACCGTGG + Exonic
1106928493 13:34637855-34637877 TACCCTATGCTCCACCAGCTGGG - Intergenic
1107830863 13:44373326-44373348 TGCAGTGGGGTCCCCCAGCGTGG + Intergenic
1107869783 13:44735774-44735796 AGCCCTGGGCTGCCCCCGCGTGG - Intergenic
1112447034 13:99473542-99473564 GAGGCTGGGATCCCCCAGCGTGG + Intergenic
1112494219 13:99893123-99893145 CACGCTGGGCTGCCCCAGAGCGG + Exonic
1113890690 13:113734271-113734293 TGCCCTGGGCAGGCCCAGCGAGG + Intronic
1113958530 13:114112600-114112622 AACCCGGGGCTCTCCTAGCGGGG - Intronic
1114492983 14:23114777-23114799 TCCCCTGGGCTAGCCCAGCACGG + Intergenic
1115652814 14:35415316-35415338 TACCCTGGGCTCCACCCCAGAGG - Intergenic
1116039104 14:39664039-39664061 AACCCTTGGCTCCTCCAGCCGGG - Intergenic
1117426651 14:55605510-55605532 TACTCTGGGCACCACCAGCTGGG + Intronic
1122817538 14:104320973-104320995 TGGCCTGGGCTCCGCCAGGGAGG + Intergenic
1122954746 14:105065376-105065398 TACCCAGGGCCCCGCCTGCGTGG + Exonic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1125375613 15:39025694-39025716 TACCCTGGGCTGTCCAAGGGAGG - Intergenic
1126015712 15:44348396-44348418 TACCCTGGCCTCCCCATGGGAGG + Intronic
1127323159 15:57867310-57867332 TACACAGTGGTCCCCCAGCGAGG - Intergenic
1128218231 15:65949210-65949232 TCCCCCGGCCTCCCCCAGCTGGG - Intronic
1129823931 15:78621950-78621972 TAGCGTGGGCTCCCACAGCTGGG - Intergenic
1129986495 15:79923620-79923642 TCGCCAGGGTTCCCCCAGCGCGG + Exonic
1133036382 16:3036348-3036370 AGCCCTGGGCTCCCCTAGGGCGG + Intronic
1135589051 16:23692166-23692188 TGCCCAGGGCTCCCTCACCGTGG + Exonic
1136171925 16:28495012-28495034 TAACCTGGGCTCCTCCAGCCAGG + Intronic
1136687293 16:32002927-32002949 TTCCCTGTGCCACCCCAGCGGGG + Intergenic
1136787905 16:32946478-32946500 TTCCCTGTGCCACCCCAGCGGGG + Intergenic
1136881876 16:33907311-33907333 TTCCCTGTGCCACCCCAGCGGGG - Intergenic
1137861809 16:51854530-51854552 TCCCATGGGCTCCTCCAGCGAGG + Intergenic
1139729525 16:68931173-68931195 TTCCCTTGGCTCCATCAGCGAGG + Intronic
1142141896 16:88476244-88476266 CATCCTGGGCTCCCCCAGCAGGG - Intronic
1142357983 16:89612895-89612917 TACCGTGGGCTCCCAGAGCTCGG - Intergenic
1142414971 16:89936366-89936388 TTCCCTGGCCTCCCACAGAGCGG + Intergenic
1203090135 16_KI270728v1_random:1208135-1208157 TTCCCTGTGCCACCCCAGCGGGG + Intergenic
1142900501 17:3008484-3008506 TGCCCTGGGCTCCCCAACCCAGG - Intronic
1145868911 17:28257862-28257884 TACCCTGGTGGCCCCCAGTGTGG + Intergenic
1147110209 17:38256629-38256651 TCCCCAGAGCTCCCGCAGCGCGG + Intergenic
1147148272 17:38498596-38498618 TTCCCTGTGCCACCCCAGCGGGG + Intronic
1147249425 17:39144146-39144168 TTCCCTGGCCACCCCCAGCTGGG - Intronic
1147920452 17:43913562-43913584 TGCCCAGGGCTCCCCCATCATGG - Intergenic
1148419299 17:47531790-47531812 TCCCCAGAGCTCCCGCAGCGCGG - Intronic
1150628338 17:66858263-66858285 CACCCTGGGCTCAGCCAGCCTGG + Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1151587992 17:75022757-75022779 TACCGTGGGCTCCCAGAGCTGGG + Intergenic
1152245324 17:79182361-79182383 TACCCTGGCCTCACCCACCCTGG - Intronic
1152381608 17:79945169-79945191 TTCCCTGGGCCACCCCAGCCTGG + Intronic
1152575116 17:81136518-81136540 TACCCTGGGCTCCCCCCAGCAGG + Intronic
1152888595 17:82867104-82867126 AAACCTGGGCTCCCCTACCGAGG + Intronic
1154200506 18:12296566-12296588 TACCCTGGGCACTCCCAGCCAGG - Intergenic
1154345783 18:13542582-13542604 TACCGTGGGCTCCTCCAGGGAGG + Intronic
1155173241 18:23282599-23282621 TACCCTGGGGCCCCCAAGTGAGG + Intronic
1158202866 18:54959463-54959485 TGCCCTGGGCGCGCCCCGCGGGG - Exonic
1160053970 18:75462347-75462369 CACACTGGGCTTCCCCAGAGGGG - Intergenic
1160517688 18:79487519-79487541 GCCCCTGGGCTCGCACAGCGCGG + Intronic
1161318973 19:3632398-3632420 AGCCCTGAGCTCCGCCAGCGTGG + Exonic
1162134693 19:8548182-8548204 CACCCTGGGCTGCCCCAGGGAGG + Intronic
1163469067 19:17486470-17486492 TGCCCTGGGGTCCTCCAGCGGGG + Intronic
1164617931 19:29677720-29677742 TTCCCTGGGATCCCCAAGGGCGG + Intergenic
1165527521 19:36368751-36368773 TACCCTTGCCTTCCCCAGCCAGG + Intronic
1165724669 19:38104458-38104480 TTCCCAGAGCTCCGCCAGCGTGG + Intronic
1166060491 19:40322519-40322541 TCCCCTGGACTCCCCCATCATGG - Intronic
1166128836 19:40733334-40733356 TACCCTGGGCTTCCGGATCGAGG + Exonic
1167372351 19:49090742-49090764 TACCTTGGGCTCCTCCTGCATGG + Intronic
1168133758 19:54337329-54337351 CCACCTGGGCTCCCCCAGCAGGG + Intronic
1168187628 19:54709898-54709920 CCACCTGGGCTCCCCCAGCAGGG - Intergenic
927861449 2:26562609-26562631 CACCATGGCCTCCCGCAGCGCGG + Exonic
929157092 2:38798177-38798199 TGCCCTGGGCTCCTCCACCAGGG + Exonic
942446323 2:176080971-176080993 TACCCTGTGGTCTCCCAGCTGGG + Intronic
942816767 2:180061338-180061360 TACCATGGGCTCCCAGAGCTCGG + Intergenic
942816834 2:180061795-180061817 TAGCCTGGGCTAACCCAGCAAGG + Intergenic
948827072 2:240578012-240578034 TCCCCTGGGCTCTCCCAGGCAGG + Exonic
948829454 2:240591065-240591087 TACCATGGGCTGCCCCAGGAGGG + Intronic
948931607 2:241135868-241135890 TACCCTGGCCCCCCTCAGCTGGG + Exonic
1169044422 20:2524646-2524668 CCCCCTGGGCTCCCCCGGCGGGG - Intronic
1170322412 20:15114839-15114861 TGCCCTGGTTTCCCCCAGTGAGG + Intronic
1173979059 20:47208900-47208922 TACCCTGTGCACCTCCAGCCAGG + Intergenic
1180093585 21:45544200-45544222 TGCCCTCGGGTCCCCCTGCGTGG + Intronic
1180186386 21:46141906-46141928 TGCCCTGGGCCCCCCCGGGGAGG + Intronic
1183061297 22:35337908-35337930 TGCCCTGGGCACCCCCACTGCGG + Intronic
1183256748 22:36767259-36767281 AACTCAGGGCTCCCCCAGCTGGG - Intronic
1183453226 22:37907573-37907595 TTGCCAGGGCTCCCCCAGCCTGG + Intronic
1183601143 22:38841317-38841339 AAGCCAGGGCTCCCCCAGCCTGG + Intronic
1183994072 22:41620395-41620417 TGCACTGGGCTACCCGAGCGAGG + Intronic
1184109580 22:42387166-42387188 TCCCCTGGGCTCCCACGGTGGGG - Intronic
1184471155 22:44697243-44697265 TACCCTGGGCTCCCCCAGCGTGG + Intronic
1184783351 22:46659928-46659950 GTCCCTGGGATCTCCCAGCGTGG - Intronic
1185344612 22:50305850-50305872 TTCCATGGTCTCCCCCAGAGGGG + Intronic
952784962 3:37144060-37144082 TACCCTGGGCACCCCAAGACAGG + Intronic
954304429 3:49717926-49717948 TGCCCAGGGCTCCCCCACCCAGG - Exonic
954378314 3:50206168-50206190 TCCCCTGGCCTCCCCCTGCCTGG - Intronic
964974032 3:162598792-162598814 TAGCATGGGCTCCCACAGCTCGG + Intergenic
966914495 3:184577400-184577422 TATCCTGGGCACCCCCAGAGCGG + Exonic
969250962 4:5968540-5968562 TACCCTGGACTCTCCCACCCCGG + Intronic
971150609 4:24027573-24027595 TACCCTGGGCTCAACCTGTGGGG + Intergenic
972333279 4:38082724-38082746 TGCCCTGGGCTCGCCCACCCAGG + Intronic
980013557 4:127623139-127623161 TGCCCCGAGCTCCCACAGCGAGG + Intergenic
984157130 4:176206841-176206863 TACCCTGGGCTACTCCTGCAGGG + Intergenic
984916565 4:184730290-184730312 AACCCTGGGATCCCCCTGCAGGG - Intronic
985669924 5:1201939-1201961 GACCCTCGGCTCCCCAAGCACGG + Intronic
986876023 5:12110984-12111006 CACCCTGGACTTCCCCAGAGAGG + Intergenic
987370661 5:17189747-17189769 TTCCCTGGGCGACCCCAGCATGG + Intronic
988456801 5:31394020-31394042 TACCGTGGGCTCCCAGAGCTCGG - Intergenic
1000507383 5:162138006-162138028 TACCTTGTGCTCCCCAAGTGAGG + Intronic
1001700895 5:173705838-173705860 TCCCCTGGGCCTCCCCACCGTGG + Intergenic
1001940584 5:175736889-175736911 TGTCCTGGCCTCCCCCAGCCTGG - Intergenic
1006909663 6:37555735-37555757 TCCCCTGAGCTCCCCCTGCTTGG - Intergenic
1014253601 6:119139985-119140007 CACCCTGGGCAGCCCCAGCAAGG - Intronic
1020507835 7:9016942-9016964 TACCGTGGGCTCCCAGAGCTTGG + Intergenic
1022101837 7:27173685-27173707 CGCCCTGGGCACCTCCAGCGGGG - Exonic
1022644593 7:32218472-32218494 TACCCTGGGCTGCACGAGCCAGG - Intronic
1029172410 7:98640400-98640422 GACCCTGGGTTCTCCCAGTGGGG - Intergenic
1030353646 7:108519644-108519666 TTCCCTGGGCTCCTTCAGCCTGG - Intronic
1033221157 7:139526808-139526830 AGGCCTGGGCTCCCCCAGCAGGG - Intronic
1035125998 7:156607949-156607971 CACCCCGCGCTCCCCCTGCGAGG + Intergenic
1037457741 8:19081051-19081073 TTCCCTGGGTTCCCACAGAGGGG + Intronic
1037892969 8:22633606-22633628 TCTCCTGCGCTCCCCCAGCAAGG - Intronic
1040325466 8:46339342-46339364 CACCCAGGGCTGTCCCAGCGGGG + Intergenic
1040656799 8:49519777-49519799 CACCCTGGCCTCCCACAGTGAGG + Intergenic
1047739289 8:127794263-127794285 TACCCTCCGCTCCCCCAGTCTGG + Intergenic
1049223684 8:141439693-141439715 TACCCTGGGCCCCCACAGCAAGG + Intergenic
1049332745 8:142063840-142063862 CAGCCTGGGAACCCCCAGCGTGG + Intergenic
1049432452 8:142571620-142571642 AACCCTGGGCTCCCCTCGCTTGG + Intergenic
1049749205 8:144275532-144275554 TGGGCTGGGCTCCACCAGCGTGG - Intronic
1052528722 9:29655244-29655266 TACCGTGGGCTCCCAGAGCTTGG - Intergenic
1053014111 9:34652141-34652163 CGCCCTGGGCCCCCGCAGCGGGG - Intronic
1056539483 9:87558967-87558989 TACCCTCCCCTCCCCCAGAGTGG - Intronic
1057171705 9:92966758-92966780 TCCCCTGGACACCCCCAGCTGGG + Intronic
1057570580 9:96201394-96201416 TGCCCTGCGCTCCCTCAGTGGGG + Intergenic
1059471065 9:114505215-114505237 TGCCCGGGGCTCCCCCAGCCGGG + Intronic
1060911204 9:127352533-127352555 TACCCTGGGCTCCCACAAAATGG - Intronic
1061059523 9:128243557-128243579 AACCCTGGCCTCCCCCACCATGG + Intronic
1061348233 9:130043308-130043330 TCCCCCGGGCTCCCCCGGCCGGG + Intergenic
1061970655 9:134043347-134043369 GAGCCTGGGCTGCCCCAGGGAGG - Intronic
1061975945 9:134068101-134068123 TCCCCTGGGCGGCCCCGGCGCGG - Intronic
1062496218 9:136833034-136833056 CGCCCTGGGCTGCCCCAGCTGGG + Intronic
1062496281 9:136833206-136833228 CGCCCTGGGCTGCCCCAGCTGGG + Intronic
1062496297 9:136833250-136833272 CGCCCTGGGCTGCCCCAGCTGGG + Intronic
1062496361 9:136833425-136833447 CGCCCTGGGCTGCCCCAGCTGGG + Intronic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1062496424 9:136833600-136833622 CGCCCTGGGCTGCCCCAGCTGGG + Intronic
1192757932 X:74066077-74066099 TACCCCATGCTCCCCCAGCCAGG + Intergenic
1202435578 Y:24833761-24833783 TACTCTGCGCACCCACAGCGTGG + Intergenic