ID: 1184472803

View in Genome Browser
Species Human (GRCh38)
Location 22:44705188-44705210
Sequence CGCTCCCACCAGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 671
Summary {0: 1, 1: 5, 2: 39, 3: 153, 4: 473}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184472796_1184472803 17 Left 1184472796 22:44705148-44705170 CCCTCACAGTTCTGGAGCCAGAA 0: 1
1: 0
2: 6
3: 53
4: 315
Right 1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG 0: 1
1: 5
2: 39
3: 153
4: 473
1184472799_1184472803 0 Left 1184472799 22:44705165-44705187 CCAGAAGCTTGAAGTCCAGGTGT 0: 1
1: 1
2: 9
3: 66
4: 636
Right 1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG 0: 1
1: 5
2: 39
3: 153
4: 473
1184472797_1184472803 16 Left 1184472797 22:44705149-44705171 CCTCACAGTTCTGGAGCCAGAAG 0: 1
1: 0
2: 15
3: 93
4: 572
Right 1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG 0: 1
1: 5
2: 39
3: 153
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184472803 Original CRISPR CGCTCCCACCAGAGGCTCTA GGG Intronic
900682181 1:3923130-3923152 GGCTCCTTCCAGAGGCTCTAAGG - Intergenic
900726165 1:4217746-4217768 TGCTCTCTCCGGAGGCTCTAGGG - Intergenic
900934414 1:5756162-5756184 CGCTTCTTCCAGAGGCTCCAGGG + Intergenic
900941464 1:5801369-5801391 TGCTCCCTCCAGAGGCTCTGGGG - Intergenic
901108517 1:6776623-6776645 CACTCCTTCCAAAGGCTCTAGGG - Intergenic
901239448 1:7684474-7684496 TGCCCCCACCAAAGGCGCTAGGG + Intronic
901424290 1:9171590-9171612 TACTCCCACTGGAGGCTCTAGGG - Intergenic
901568839 1:10142690-10142712 CATTCCCTGCAGAGGCTCTAGGG + Intronic
901937236 1:12635323-12635345 CAGTCCCTCCAGAGGTTCTAGGG - Intergenic
902226626 1:15000282-15000304 GGCTCCCACCGGAGGCTATAGGG - Intronic
904113867 1:28147695-28147717 AGCTCCCATCAGAGGATCAAGGG + Exonic
907908478 1:58806722-58806744 CGCTCCCTCCAAGGGCCCTAAGG + Intergenic
908244021 1:62213379-62213401 TGCTCACACCAGAAGATCTAGGG - Intergenic
909477959 1:76103661-76103683 CACTCCCTCCAAAGGCTCTAGGG + Intronic
909532117 1:76693018-76693040 CCCTCCCATCAGAGGCTCAGAGG - Intergenic
910202484 1:84713873-84713895 TACTCCCTCCAGGGGCTCTAGGG + Intergenic
910310973 1:85824275-85824297 CGCTCCCTCTAGAGGCTCTAGGG - Intronic
910502326 1:87907059-87907081 TGCTTCCTCCAGAGGCTCTGTGG + Intergenic
910989685 1:93042212-93042234 CCCTCCCAACAGCGGCTCAAAGG + Intergenic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
911838547 1:102652176-102652198 CACTCTCTCCAGAGGCTCTCGGG + Intergenic
912012622 1:104987226-104987248 TGTTCCCTCCAGAGGCTCTATGG - Intergenic
913057338 1:115174760-115174782 TGCTCCCTCCAGAGGCTCTGAGG + Intergenic
913135265 1:115882340-115882362 CACTCCTTCCAGAGTCTCTAGGG - Intergenic
913293286 1:117294993-117295015 TGCTCCCTCCAGACACTCTAGGG - Intergenic
914254936 1:145954199-145954221 TGCTCCCTCCAGAAGCTCTAGGG - Intronic
915254405 1:154615096-154615118 TGCTCCCTCCAGAGGCTGTAGGG - Intronic
915742704 1:158131431-158131453 GGCTCCCTCCAGAGGCTATAGGG - Intergenic
916358190 1:163936740-163936762 CGCTGCCTACAGAAGCTCTAGGG + Intergenic
916374168 1:164133833-164133855 TGCTCCCTCTGGAGGCTCTAAGG - Intergenic
916489647 1:165290313-165290335 CGCTCCCTCTAGAGGCTTAAGGG + Intronic
916801865 1:168223423-168223445 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
916846568 1:168656958-168656980 TGCTTCCTCCAGAGCCTCTAGGG + Intergenic
917261442 1:173173833-173173855 CCCTCCCATCACAGGCTCTGAGG - Intergenic
917437292 1:175034194-175034216 CGCTCCCTCCAAAGGCTCTAGGG + Intergenic
918009045 1:180569470-180569492 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
918076853 1:181177106-181177128 CGCTCCCTCGGGAGGCTCTGGGG - Intergenic
918083395 1:181224529-181224551 CACTCCCTCTGGAGGCTCTAAGG - Intergenic
918342449 1:183578871-183578893 CCCTCCCACCAGGGCCTCTGTGG - Intronic
920666667 1:207967718-207967740 CGCTCCCTCCAAAGCCTATAGGG - Intergenic
920760292 1:208777253-208777275 CTCTTCCTCCAGAGGTTCTAGGG - Intergenic
921275781 1:213518489-213518511 GGCTCCCTGCAAAGGCTCTAGGG - Intergenic
921354945 1:214277104-214277126 CACTCCCTCCCGAGGCTCTAGGG + Intergenic
921445943 1:215247811-215247833 TGCTCCCTCCAGGGCCTCTAGGG + Intergenic
921826687 1:219679794-219679816 TGCTCCTTCCAAAGGCTCTAGGG - Intergenic
922174517 1:223186695-223186717 CACTCCCTCTAGAGACTCTAGGG - Intergenic
922778119 1:228226796-228226818 TGCTCCCTCAGGAGGCTCTAGGG - Intronic
922792121 1:228316425-228316447 CGCTGAGACCAGAGGCTCTCCGG + Intronic
923312393 1:232747602-232747624 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
923313022 1:232754557-232754579 GGCTCCCTCCAGAGGGTCTAAGG - Intergenic
923808803 1:237289183-237289205 CGCTTCCTTCAGAGGCTCTGTGG + Intronic
923982151 1:239337181-239337203 TGCTCCCTCCAGAGACTCTAGGG + Intergenic
1063715094 10:8519258-8519280 CACTCCTTCCAGGGGCTCTAGGG - Intergenic
1063868779 10:10396111-10396133 CACTCTCTCCAGAGGTTCTAGGG - Intergenic
1063868960 10:10397712-10397734 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1064368268 10:14727727-14727749 CTCTCCCACCAGGGCTTCTAGGG + Intronic
1065004031 10:21363098-21363120 CACTCCCTTCAGAGGCTCTAGGG - Intergenic
1066252563 10:33648771-33648793 TGCTCCCTCCAGAGGCTGGAGGG + Intergenic
1067099672 10:43325512-43325534 CACTTCCTCCAGAGCCTCTAGGG + Intergenic
1067218626 10:44324707-44324729 CACTCCCTCCAGTGCCTCTAGGG - Intergenic
1067735283 10:48845698-48845720 CTCTCTCCCCAGAGGCTTTATGG + Intronic
1068525770 10:58127724-58127746 CACTCCCTCCAGAGGCTCTATGG + Intergenic
1069106181 10:64385518-64385540 CCCTCCCATCACAGGCTCTGAGG - Intergenic
1070406955 10:76105660-76105682 CACTCCCTCCAAAGGCTCTAGGG - Intronic
1070512880 10:77177114-77177136 GGGTCTCTCCAGAGGCTCTAGGG - Intronic
1070655459 10:78268089-78268111 CGCTCCTTCTGGAGGCTCTAGGG - Intergenic
1070723092 10:78770215-78770237 CAGTCCCTCCAGAGGCTCCAGGG + Intergenic
1071404598 10:85317984-85318006 CACTCTCTCCAGAGGCTCTAGGG + Intergenic
1071876574 10:89849471-89849493 CTCTCCCTCCAGAGGTTCCAGGG - Intergenic
1074100599 10:110351887-110351909 TGCTCCCTCCAAAGGATCTAGGG - Intergenic
1074311070 10:112323815-112323837 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1074600362 10:114907754-114907776 CGCTCCCTCCAAAGTCTCTAAGG - Intergenic
1074927780 10:118091434-118091456 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1075127398 10:119711566-119711588 TTCTCCCTTCAGAGGCTCTAAGG + Intergenic
1075245484 10:120818505-120818527 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1075662482 10:124207713-124207735 TACGCCCTCCAGAGGCTCTAGGG + Intergenic
1076435107 10:130435221-130435243 TGTTCCCACCAGAAGCTCTGGGG - Intergenic
1076444312 10:130501495-130501517 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1076479605 10:130776296-130776318 CGCTTCCCCCGAAGGCTCTAGGG + Intergenic
1076651688 10:131994015-131994037 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1076899801 10:133332906-133332928 TGCTCCCTCCAAAGCCTCTAGGG - Intronic
1077166926 11:1146498-1146520 CGTTCCTTCCAGAGGCTCCAGGG + Intergenic
1077542025 11:3151200-3151222 CGCTCCCTCCGAAGGCTCTGGGG - Intronic
1078928461 11:15894926-15894948 TGCTCCCTCCAAAGGCTCTAAGG + Intergenic
1079794292 11:24779983-24780005 AGCTCCCTCCAGAGGCCCTACGG - Intronic
1080048623 11:27835946-27835968 CACTCTCTCCTGAGGCTCTAAGG + Intergenic
1081763731 11:45594777-45594799 CCCTCCCACCCCAGGCTCTGAGG + Intergenic
1083287810 11:61671742-61671764 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1083708137 11:64530661-64530683 TGCACCCTCCAGAGGCTCTGAGG - Intergenic
1083925162 11:65801648-65801670 CTCTCCCACCTTAGGCTCCAGGG + Intergenic
1084681384 11:70668460-70668482 CGCTCCCTCCGGGGGCTCCAGGG - Intronic
1084712597 11:70853146-70853168 CACTCTCCCCACAGGCTCTAAGG - Intronic
1084714537 11:70865241-70865263 GCATCCCACCACAGGCTCTAAGG + Intronic
1085342295 11:75740899-75740921 ACTTCCCTCCAGAGGCTCTAGGG + Intergenic
1085909870 11:80810211-80810233 GGATCCCTCCAAAGGCTCTAGGG - Intergenic
1085942577 11:81222658-81222680 CCCTCCCACAAGGGGCTCCAAGG + Intergenic
1087015929 11:93554748-93554770 CGCTCCCACTTGAGGGTCTGGGG + Intergenic
1087021849 11:93611059-93611081 GCCTCCCTCCAGAGGCTCCAGGG + Intergenic
1088332341 11:108666595-108666617 TGCTCCCTCCAGAGGTTCTAGGG + Intronic
1088536123 11:110863635-110863657 CACTACCTCCATAGGCTCTAGGG + Intergenic
1089047443 11:115515277-115515299 CTCAGCCTCCAGAGGCTCTATGG - Intergenic
1089746707 11:120622730-120622752 TGCTCCCGCCAAAGGCCCTAGGG + Intronic
1089966629 11:122658946-122658968 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1090230911 11:125103055-125103077 TGCTCCCTCCAAAGGCTCTAGGG + Intronic
1090742910 11:129682313-129682335 TGCTCCCTCCAAAGGCTCTGAGG + Intergenic
1090912553 11:131134113-131134135 TGCTCCTTCCAGAGGCTTTAGGG + Intergenic
1090919694 11:131196955-131196977 AGCTGTCACCAGAGGCTCCAAGG - Intergenic
1090977063 11:131687625-131687647 CACTCCCACCCGAGGCACTTGGG - Intronic
1093533387 12:20194353-20194375 TGCTCCCTCCAGAGGCTGTAGGG + Intergenic
1093801852 12:23383061-23383083 CACTCACACCCGAAGCTCTAGGG - Intergenic
1094241889 12:28237620-28237642 GGCTCCCTCTGGAGGCTCTAGGG - Intronic
1095382763 12:41615366-41615388 CCCTCCCACCACAGGCCCTGAGG + Intergenic
1095569621 12:43669570-43669592 TGCTGCCTCCAGAGGCTCTAGGG - Intergenic
1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG + Intergenic
1096131555 12:49163071-49163093 GGTTCCTACCAGAGGCTCTGAGG - Intergenic
1096637714 12:52971651-52971673 CCCTCCCACCATCAGCTCTAAGG - Intergenic
1096883271 12:54690214-54690236 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1097544170 12:60978151-60978173 CACTGCCCCCAGAGGCTCCAGGG + Intergenic
1098549886 12:71751579-71751601 AACCCCCTCCAGAGGCTCTAGGG + Intergenic
1098965536 12:76783950-76783972 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
1099804890 12:87506499-87506521 CATTCTCTCCAGAGGCTCTAGGG - Intergenic
1099972753 12:89516745-89516767 CACTCTCTCCAAAGGCTCTAGGG + Intronic
1100023285 12:90097338-90097360 TGCTCCTTCCAGAGGTTCTAAGG - Intergenic
1100371059 12:93969061-93969083 CACTCCCTCCAGGGGCTCTCGGG + Intergenic
1100771851 12:97932105-97932127 TGCTCCCACTGAAGGCTCTAGGG + Intergenic
1100930123 12:99598933-99598955 CGCTCCCTCCAGAGGCTCTAGGG + Intronic
1100932971 12:99632011-99632033 CTCTCCCATCACAGGCTCAAAGG + Intronic
1101308755 12:103556977-103556999 CACTCCCTCCAAAGGCTCTGTGG - Intergenic
1101395122 12:104340507-104340529 AGCTCCCTCCAAAGGCACTAGGG + Intronic
1102568085 12:113810165-113810187 TGCTCCCTCCGAAGGCTCTAGGG - Intergenic
1102624070 12:114220516-114220538 CGCCCCCACCTGATGCTTTATGG + Intergenic
1102935243 12:116891047-116891069 TGCTCCCTCCAAAGGCCCTAGGG - Intergenic
1103166126 12:118772192-118772214 CGCTCCCTCCAAAGGCTCTAGGG - Intergenic
1103268880 12:119655573-119655595 TGCTCCCACCTCAGCCTCTAAGG + Intergenic
1103840906 12:123863509-123863531 CACTCCCTCCGAAGGCTCTAGGG + Intronic
1103920065 12:124394708-124394730 CATTCCCTCCAGAGGCTCTGGGG - Intronic
1103965089 12:124633545-124633567 GGCAACCACAAGAGGCTCTAGGG - Intergenic
1104056068 12:125231072-125231094 TGCTCCCTCCGGAGGCTCTAGGG + Intronic
1104244260 12:127022409-127022431 TGTTCTCTCCAGAGGCTCTAGGG - Intergenic
1104288069 12:127443484-127443506 TGCTCCCTCCGAAGGCTCTAGGG - Intergenic
1104467183 12:128999994-129000016 TGCTCCCTTCAGAGGCTCTAGGG + Intergenic
1104493660 12:129216569-129216591 TGCTCCCTCTGGAGGCTCTAGGG - Intronic
1104587699 12:130060802-130060824 TGCTCCCTGCAGAGGCTCTAGGG - Intergenic
1104731461 12:131107647-131107669 TGGTCCCACCAGAGCCTCTGGGG + Intronic
1104922055 12:132295664-132295686 CGCTCCCTCCATAGTCTCCAGGG - Intronic
1107401593 13:40074601-40074623 GGCTCCCAGGAAAGGCTCTAAGG - Intergenic
1108554750 13:51582090-51582112 TGCTCCCACCCCAGGCTTTATGG - Intergenic
1110146816 13:72202006-72202028 TGTTCCCTCTAGAGGCTCTAGGG - Intergenic
1110367918 13:74708545-74708567 CATTCCCTGCAGAGGCTCTATGG - Intergenic
1111514219 13:89306713-89306735 TGATCCCTCCAGAGGCTCTGGGG + Intergenic
1111835780 13:93386789-93386811 AGTTCCCTCCAGAGGCTCTGGGG + Intronic
1112207203 13:97336645-97336667 CCCTCCCTCCAGAGGCTCTAGGG - Intronic
1112228304 13:97562962-97562984 TTCTCCCACAAAAGGCTCTAGGG + Intergenic
1112366161 13:98757239-98757261 TGCTCCCTCCAGAGGCTCTGGGG + Intergenic
1112569452 13:100580473-100580495 CCCTCCCTCCAAAGGCTGTATGG - Intronic
1113084193 13:106550713-106550735 CACTTCCTCCAGAGGTTCTATGG + Intronic
1113466951 13:110519705-110519727 CACTCCCACCAGGGTCTCTGGGG + Intergenic
1113813545 13:113156475-113156497 CCCTCCCAAAAGAGGCTCCAGGG + Intergenic
1114572104 14:23678345-23678367 TGCTCTCTCCAGAGGCTCTGGGG - Intergenic
1115480455 14:33856086-33856108 TGCTCCCACTTGAGGCTCTAAGG - Intergenic
1115564473 14:34613202-34613224 CTCTCCCTCCGGAGGCTCTAGGG - Intronic
1117058061 14:51933074-51933096 TGCTCCTGCCAGAGGCTCTAGGG - Intronic
1118524327 14:66622356-66622378 CCCTCCCATCACAGGCTCAAAGG - Intronic
1119042245 14:71285555-71285577 GGCTCCCTCCAGAGGTTCTAGGG + Intergenic
1119128469 14:72150310-72150332 CGCTCCCTCTGAAGGCTCTAGGG - Intronic
1119678651 14:76575427-76575449 CACTCCCTCCAGAAGCTCTAGGG + Intergenic
1119689589 14:76661104-76661126 TGATCCCTCCAGAGACTCTAGGG + Intergenic
1120185606 14:81390851-81390873 CACTCCCCGCAGAGGCTTTAAGG + Intronic
1120487928 14:85138153-85138175 CGCTCTCTCCAAAGGCTCTGGGG + Intergenic
1120825599 14:88952046-88952068 CACTCCCTCCAAAGTCTCTATGG - Intergenic
1121171141 14:91855365-91855387 TGCTCCCTCCAGAGGCTCTAGGG + Intronic
1121211749 14:92212534-92212556 GGCTCCCTCCAAAGGCTCCAGGG - Intergenic
1121553008 14:94816290-94816312 GGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1121676845 14:95760424-95760446 CCCTCCCACCACAGTCTCTCTGG - Intergenic
1121913116 14:97810426-97810448 TGCTCCCTCCAGAGGCTCTTGGG + Intergenic
1121918779 14:97860892-97860914 CACTCCCTCCAAAGCCTCTAGGG - Intergenic
1122049053 14:99042816-99042838 CGCTCCCGCCACAGGCCCGAGGG + Intergenic
1122294929 14:100700077-100700099 TGCTCTCTCCAGAGGCTCTAGGG - Intergenic
1122341940 14:101034218-101034240 CGCTCTCTCCAGAGGCTTGAGGG + Intergenic
1122659840 14:103287847-103287869 CGCTCCCTCCTGGGGGTCTAGGG - Intergenic
1123788286 15:23694130-23694152 TGCTCCTACCAAAGGCTTTAAGG + Intergenic
1124050896 15:26196856-26196878 TTCTCCCTCCAGAGGCTCCAGGG - Intergenic
1124595257 15:31086593-31086615 CTCTCCCAGCAGGGGCTCCAGGG + Intronic
1126075052 15:44901012-44901034 AGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1126083312 15:44986809-44986831 AGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1126451670 15:48815235-48815257 TGCTCCCTCCAAAGGCTCTAGGG - Intergenic
1126878028 15:53065151-53065173 CGCTTCCTCCAGAGGCTCTTGGG - Intergenic
1126910727 15:53414682-53414704 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1127640296 15:60909758-60909780 CTCTCTTTCCAGAGGCTCTATGG - Intronic
1127699433 15:61483794-61483816 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1127715578 15:61645925-61645947 GGCTTCCTCCAAAGGCTCTAAGG - Intergenic
1127811487 15:62568999-62569021 TGCTCCCTCCAAAGGCTCTGGGG + Intronic
1129181985 15:73883403-73883425 GGCTCCTTCCAAAGGCTCTAGGG + Intronic
1129620132 15:77136882-77136904 CCCTCCCATCAGAGGCCCGAAGG + Intronic
1129814908 15:78543309-78543331 TGGTCCCAACAGAGGCTCTGTGG - Intronic
1130042938 15:80419895-80419917 GGCTCTCACCAGAGGGTCTTAGG + Intronic
1130330749 15:82920457-82920479 TGCTGCCTCCAGAGGCTCTAGGG + Intronic
1130938109 15:88487256-88487278 TGCTTCCTTCAGAGGCTCTAGGG - Intergenic
1131078417 15:89513772-89513794 AGCTCCCACCAGAGCCAGTAGGG - Intergenic
1131885447 15:96907465-96907487 CCCTCCCACCAGGGGTTCGAGGG - Intergenic
1132414031 15:101607899-101607921 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1132609275 16:807283-807305 CGATCCCTCCAGAGGCTATAGGG - Intronic
1132675668 16:1120386-1120408 GGCTTCCTCCAGAGGCTCCAGGG + Intergenic
1133626587 16:7575596-7575618 CACTTCCTCTAGAGGCTCTAGGG - Intronic
1133712150 16:8411682-8411704 CCCACCCACCACAGGCTCTGTGG + Intergenic
1133852215 16:9516183-9516205 CACTTCCTCCAGGGGCTCTAGGG - Intergenic
1133854786 16:9539427-9539449 CACCCCCTCCAGAGGCTCCAAGG - Intergenic
1133882881 16:9799398-9799420 CGCTTCCACCGAAGGCTCCAGGG - Intronic
1134077490 16:11302167-11302189 GGTTCCTCCCAGAGGCTCTAGGG + Intronic
1134475081 16:14566446-14566468 AGCTCCCTCCAGAGGCTCTGGGG - Intronic
1134597835 16:15510102-15510124 CGCGCTCTCCAGAGGCTCTAGGG - Intronic
1135527023 16:23221382-23221404 TGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1136702378 16:32156135-32156157 TGCTCCCTCCACAGGCTCTAGGG - Intergenic
1136765289 16:32771353-32771375 TGCTCCCTCCACAGGCTCTAGGG + Intergenic
1136802810 16:33099031-33099053 TGCTCCCTCCACAGGCTCTAGGG - Intergenic
1137667311 16:50259308-50259330 CCCTCCCACCAGATCCTCAAAGG - Intronic
1137801413 16:51265546-51265568 TAGTCCCTCCAGAGGCTCTAGGG + Intergenic
1138646682 16:58430677-58430699 CGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1140615010 16:76651492-76651514 CGCTCCCTCTACAGCCTCTAGGG - Intergenic
1140719694 16:77760256-77760278 TGCTCCCTCCGGAGGCTCTGGGG + Intergenic
1140871944 16:79114574-79114596 CGCTCCCTCCGAAGGCTCTAGGG - Intronic
1141070179 16:80947226-80947248 TGCTCCCTCCAAAGACTCTAGGG - Intergenic
1141192660 16:81835775-81835797 TGCTCCCGCTGGAGGCTCTAGGG + Intronic
1141537381 16:84691858-84691880 TGCTCCCTCCGGAGGCTCCAAGG - Intergenic
1141656642 16:85420278-85420300 CACTCCCTCCAGAGGTACTAGGG - Intergenic
1141674736 16:85511812-85511834 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1141762172 16:86035836-86035858 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1141763678 16:86045098-86045120 CAATCCCTCCAGAGGCTCTAGGG - Intergenic
1141773892 16:86109502-86109524 TACTCCCTCCAGAGGCTGTAGGG - Intergenic
1141897897 16:86970360-86970382 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1203067677 16_KI270728v1_random:1033586-1033608 TGCTCCCTCCACAGGCTCTAGGG + Intergenic
1142884082 17:2902054-2902076 CGCTCCCTCTGCAGGCTCTAGGG + Intronic
1142884260 17:2903098-2903120 AGCCCCCACCAGATGCTATAGGG - Intronic
1142887483 17:2921775-2921797 TGTTCCCGCCAGAGGCTCGAGGG + Intronic
1144095604 17:11897941-11897963 TGCTCCCTCCAGAGGCTCTAGGG + Intronic
1144335681 17:14267147-14267169 AGTTTCCTCCAGAGGCTCTAGGG + Intergenic
1144592228 17:16534363-16534385 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1144739729 17:17575116-17575138 TGCTTCCACCAGAGGCTCTGGGG + Intronic
1144752256 17:17657235-17657257 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1145007453 17:19345618-19345640 TGCTCCCTCCCAAGGCTCTAGGG - Intronic
1146174419 17:30655964-30655986 CGCTCCCCACAGAGGATCTAGGG - Intergenic
1146347875 17:32072002-32072024 CGCTCCCCACAGAGGATCTAGGG - Intergenic
1146406100 17:32539509-32539531 TGTTCCCTCCAGAGCCTCTAGGG + Intronic
1148893925 17:50829014-50829036 CGCTCCCTCCAGAGGCTTTAGGG + Intergenic
1149008768 17:51833133-51833155 TTCTCCCAGCAGAGGCACTAAGG - Intronic
1149294962 17:55253707-55253729 CGCTCCCTCCAAAGGCACCAGGG - Intergenic
1149595617 17:57862897-57862919 GACCCCCACCAGAGGCTCTTTGG - Exonic
1150345563 17:64402225-64402247 CACTCCCTGCAGAGGCTCTGCGG + Intronic
1151025502 17:70671834-70671856 CGGTCCATCCAGAGGCTCGAGGG - Intergenic
1151202698 17:72480293-72480315 TGCTCCCTCCAAAGGCTCCAAGG - Intergenic
1151271824 17:73002806-73002828 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1151278091 17:73051108-73051130 CGCTCCCTCTAAAGGCTCTTGGG + Intronic
1151400948 17:73855680-73855702 CGTGCCTTCCAGAGGCTCTAGGG - Intergenic
1151874480 17:76859090-76859112 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1151945576 17:77318202-77318224 CACAGCCACCAGAGGCTCAAAGG - Intronic
1151999217 17:77634872-77634894 CACTCCCTCTCGAGGCTCTAGGG + Intergenic
1152212647 17:79010474-79010496 CTCTCCTGCCAGAGGCTCCACGG - Intergenic
1152372909 17:79901613-79901635 GCGTCCCTCCAGAGGCTCTAGGG + Intergenic
1152581968 17:81169608-81169630 CGCCCCCTCCAGATGCTCCAGGG + Intergenic
1153685935 18:7545402-7545424 CGCTCCCTCCAGGGGCTCTAGGG + Intergenic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1154338619 18:13485280-13485302 CACTCCTACCAGAGGCTTTGTGG - Intronic
1156032505 18:32728923-32728945 TGCTCCCTCCAAAGACTCTAGGG - Intronic
1159665184 18:71149825-71149847 CACTCCCTCCAGGGGCTCAAGGG - Intergenic
1160115337 18:76074021-76074043 CGCTCCCTCCGGAGGCTCAAGGG + Intergenic
1160299677 18:77668526-77668548 CGCTCCCGCCAGAGGCGCTGGGG - Intergenic
1160729967 19:637186-637208 CGCTCCCTCCAGAGGCCCTGGGG + Intergenic
1160784890 19:895567-895589 TGCTCCCTCCAGCGTCTCTAGGG - Intergenic
1161019204 19:2000100-2000122 CGCTCCCTCTGGAGGCTCAAGGG - Intronic
1161127189 19:2564726-2564748 GGCTCCCTCCAGAGACTCCAGGG - Intronic
1161129558 19:2579914-2579936 TGCTCCCTCCAGAGGTTCCAGGG + Intronic
1161148152 19:2692016-2692038 CGCTCCTTCTAGAGGCTCCAGGG - Intronic
1161654171 19:5503482-5503504 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1162987988 19:14284074-14284096 CGCTCCCCACAGAGGCTCTAGGG + Intergenic
1163400301 19:17088122-17088144 CACTCCCTCTGGAGGCTCTACGG + Intronic
1163413171 19:17169631-17169653 TGCTGCCTCCAGAGGCTCCAAGG + Intronic
1163605688 19:18274190-18274212 CCCTCACAGCAGGGGCTCTAGGG - Intronic
1163643199 19:18473466-18473488 GGCTCCCACCCCAGGCTCCAAGG - Intronic
1163682563 19:18691674-18691696 TGCTTCCTCCAGAGGCTCTAGGG - Intronic
1163724869 19:18917033-18917055 CACTCCTTCCAAAGGCTCTAGGG + Intronic
1163755268 19:19102922-19102944 CGTTCCCTCCAGAGGCTCTAGGG + Intronic
1164807144 19:31125812-31125834 CGCTCCCTCTAGAGGCTTCAGGG + Intergenic
1167085541 19:47307262-47307284 CACTCCCTCCAGAGGTTCCAGGG - Intronic
1167142257 19:47660163-47660185 TGCTCCCTCAGGAGGCTCTAGGG + Intronic
1167538309 19:50069461-50069483 CGCTGCCTCCAAAGGCTCCAGGG - Intergenic
1167548803 19:50145329-50145351 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1168345737 19:55649402-55649424 CGCAGCCTCCGGAGGCTCTAGGG - Exonic
1168634129 19:57982166-57982188 TGCTCCCTCCAGAAGCTCTAAGG + Intronic
925140583 2:1547314-1547336 CGCTCCCTCTGGAGGCTCTTCGG + Intergenic
925491597 2:4401099-4401121 TGCTCCCTCTAAAGGCTCTAGGG - Intergenic
926349930 2:11985170-11985192 TGCTCCCTCCAGAGGTTCTAGGG + Intergenic
926502081 2:13668186-13668208 CACTTCCTCCAAAGGCTCTAGGG - Intergenic
926764661 2:16313769-16313791 GGCTCCCTCCAGAGGCTCTAGGG + Intergenic
927233861 2:20851900-20851922 CGTTCCCTCCAAAGGCTCTAGGG + Intergenic
927641036 2:24845778-24845800 CCCTCCCACCACAGGCCCTGAGG + Intronic
927763096 2:25778410-25778432 CACTCCCTACAGAGGCTCTGGGG - Intronic
928091835 2:28379282-28379304 CGCTCCCTCTGGAGGCCCTAGGG + Intergenic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
928225988 2:29448636-29448658 CGTTCCCACCAAAAGCTCCATGG + Intronic
929029547 2:37637680-37637702 TACTCCCTCCAGAGGCTCTAGGG + Intergenic
929335866 2:40744958-40744980 GGCTCCCTCCAGAGGCTCTATGG - Intergenic
930040833 2:47121718-47121740 TGCTCCCTCCAGAGGATCTAAGG + Intronic
931264984 2:60652698-60652720 TGCTCCCTCCAAAGGCACTATGG - Intergenic
931439431 2:62277840-62277862 CCCTCCCATCACAGGCTCTGAGG + Intergenic
932404482 2:71504231-71504253 CCATTCCACCAGAGGGTCTAGGG - Intronic
932860974 2:75290920-75290942 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
933190509 2:79328850-79328872 AGCTCCCTCCAGAGGCTCAAGGG + Intronic
935586490 2:104804329-104804351 TGCTCCCTCCAGAGGCTCTAGGG + Intergenic
936346730 2:111681168-111681190 TGCTCCCTCCGGAGGCTATAAGG - Intergenic
937319633 2:120953371-120953393 CACTCCCTCCAGAGGCTCAAGGG - Intronic
937924001 2:127153959-127153981 CTATCCCAGCAGAGGCTCTGAGG + Intergenic
937927899 2:127182064-127182086 CACTCCCACCCTAGGCTCTCAGG - Intergenic
938738337 2:134206837-134206859 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
938960239 2:136334313-136334335 TGTTCCCTCCAGAGGCTCTAGGG + Intergenic
939886537 2:147686984-147687006 TGCTCTCTCCAAAGGCTCTAGGG - Intergenic
940073458 2:149715384-149715406 TGCTCCCTCCAGAGGCTCCAAGG + Intergenic
940596219 2:155795993-155796015 CCCTCCCATCACAGGCTCTTAGG - Intergenic
940781652 2:157939782-157939804 TGCTCCCCCTAAAGGCTCTAGGG - Intronic
940882119 2:158957187-158957209 TCCTCCCTCCAGAGGCTCTGGGG - Intergenic
943479485 2:188400108-188400130 CTGTCCCTCCAAAGGCTCTAGGG + Intronic
944135217 2:196391793-196391815 TCCTCCCTCCAAAGGCTCTAGGG + Intronic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
945792803 2:214326343-214326365 TGCTCCCTTCAGAGGCTCTAGGG - Intronic
946526876 2:220530228-220530250 CGCTCCCCCCAGAGGCTGCAGGG - Intergenic
947861382 2:233360904-233360926 CACTCCCTCTAAAGGCTCTAGGG - Intronic
948075205 2:235160550-235160572 CTCTCCCTCCGGAGGCTCTTGGG + Intergenic
948265901 2:236635170-236635192 TGCTCCCTCCAGGGGCTCTAGGG - Intergenic
948525902 2:238570613-238570635 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
948665235 2:239530421-239530443 TGCTCCCTCCTGAGGCTCTGCGG - Intergenic
948756449 2:240162262-240162284 CGCTCGCCGCAGAGGCTCCAGGG - Intergenic
948759388 2:240181201-240181223 TGCTCCCTCCAGCGGCTCTAGGG + Intergenic
948889248 2:240898833-240898855 GGCTCCCTCCGGAGGCTCCAGGG + Intergenic
948899177 2:240947498-240947520 CTCTGTCACCAGAGGCTCAATGG - Intronic
1168789030 20:563646-563668 CTCTCCCCTCAGTGGCTCTAGGG - Intergenic
1169070981 20:2730243-2730265 TGCTCCCTCCAAAGGCCCTAGGG + Intronic
1169342259 20:4805432-4805454 TGCTCGCACCAGGGGCTCTGAGG - Intronic
1169886080 20:10399187-10399209 TGCTCCCTCCGGAGGCTCTAGGG - Intergenic
1170210130 20:13839624-13839646 CACTCCCTTCAGAGGCTCTAAGG + Intergenic
1170863849 20:20135213-20135235 TGCTCACTCCAGAGGCTCTAGGG - Intronic
1170879280 20:20280333-20280355 TGCTCCCTCCAGAGGCTCTAGGG - Intronic
1172367734 20:34363036-34363058 CCCGCCCACCAGAGCCTATAAGG - Intergenic
1174098251 20:48106673-48106695 CATTCCTTCCAGAGGCTCTAAGG - Intergenic
1174673723 20:52332978-52333000 CGCTCCCTCAGGAGGCTCTGGGG + Intergenic
1175115054 20:56676225-56676247 TGCTCCCTCCAAAGGCTCGAGGG - Intergenic
1175119915 20:56709554-56709576 CGCTCCCTCCGGAGGCCCCAGGG + Intergenic
1175124438 20:56740886-56740908 CGCTCTCCCTGGAGGCTCTAGGG + Intergenic
1175229319 20:57463600-57463622 CACTCCCTCCAGAGGCTATAGGG - Intergenic
1175327608 20:58140627-58140649 TGCTCCCTCCAGAGCCTCCAGGG + Intergenic
1175630770 20:60534629-60534651 CACTCCTACCAGAGGCTCTAAGG - Intergenic
1175699684 20:61127906-61127928 CGCTCCCTCCGTAGGCTCTAGGG - Intergenic
1175783297 20:61697033-61697055 TGCTCCCTCCGAAGGCTCTAGGG - Intronic
1175801136 20:61801622-61801644 TGCTCCCACTGGAGGCCCTAGGG + Intronic
1175848032 20:62069222-62069244 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1176513583 21:7766922-7766944 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1177254614 21:18644978-18645000 CACTCCCACTGGAGGCTCTAGGG + Intergenic
1178164788 21:29961612-29961634 TGCTCCCTCCAGAGCCTGTAGGG + Intergenic
1178223066 21:30683298-30683320 CATTCCCTCCAGAGGATCTAGGG + Intergenic
1178357348 21:31920040-31920062 CGCTCCCTCCAGAGACTCTAGGG + Intronic
1178380576 21:32104233-32104255 CACTCCCTCAGGAGGCTCTAAGG - Intergenic
1178630188 21:34252739-34252761 CGCTCCCTGCAGAGGCTCTAGGG - Intergenic
1178647696 21:34397446-34397468 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1178863024 21:36305154-36305176 CGATCCCTCTAGAGGCCCTAGGG + Intergenic
1178911028 21:36673861-36673883 TGCTCCCTCCAAGGGCTCTAGGG - Intergenic
1179565811 21:42247924-42247946 CACTCCCTCCGGAGGCTCCAGGG - Intronic
1179808602 21:43855800-43855822 TGCTGCAACCAGAGGCCCTAGGG + Intergenic
1180052495 21:45337755-45337777 TGCCCCCTCCAGAGGCTCTGGGG - Intergenic
1180138769 21:45878210-45878232 CTCTCCCACCAGAGGACCTGTGG + Intronic
1181769951 22:25118176-25118198 GCCTCCCTCCAGAGGCTCTAGGG + Intronic
1181812399 22:25411710-25411732 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1182106332 22:27692476-27692498 TGTTCCATCCAGAGGCTCTAGGG - Intergenic
1182665324 22:31954609-31954631 CGCTCCCTCTGAAGGCTCTAGGG + Intronic
1182768510 22:32776183-32776205 TGCTCCCTCTAGAGGCTCTAGGG - Intronic
1183036932 22:35147625-35147647 TGCTCCCTCCGGAGGCTCTGGGG - Intergenic
1184472803 22:44705188-44705210 CGCTCCCACCAGAGGCTCTAGGG + Intronic
1184498929 22:44860338-44860360 TGCTCCTTCCAGAGGCTCTAGGG + Intronic
1184521070 22:44994464-44994486 CACTCCCTCCGGAGGCTCGAGGG - Intronic
1184544090 22:45153994-45154016 CGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1184559223 22:45252039-45252061 TGCTGCCTCCAGAGGCTCCAGGG + Intergenic
1184879044 22:47293498-47293520 CGCCCCCTCCGCAGGCTCTAGGG + Intergenic
1185125632 22:49009186-49009208 CACTCCCTGCAGGGGCTCTAGGG + Intergenic
949720042 3:6978304-6978326 CACTCCCTCCAGAATCTCTAAGG - Intronic
949787464 3:7757689-7757711 TGTTCCCTTCAGAGGCTCTAGGG - Intergenic
949849236 3:8405308-8405330 CACTCCCTCCAGAGGTTCAAGGG - Intergenic
949901079 3:8815197-8815219 GCCTCCCTCCAGAGGCTCCAGGG - Intronic
949939017 3:9139546-9139568 CACTCCCTCCAGCGGCTCTAGGG - Intronic
951274966 3:20673966-20673988 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
951534857 3:23731259-23731281 CACTCCCTCCAAAGGCTCTAAGG + Intergenic
952522893 3:34179791-34179813 TGCTCCCTCCAAAGGCTCTTGGG - Intergenic
953294267 3:41696980-41697002 TGTTCCTTCCAGAGGCTCTAAGG - Intronic
953453488 3:43023297-43023319 TGCTACCTCCAAAGGCTCTAGGG - Intronic
954594388 3:51812894-51812916 AGCTCCTTCCAGAAGCTCTAGGG + Intergenic
955124652 3:56099210-56099232 CACACCCCACAGAGGCTCTAAGG - Intronic
955435530 3:58895080-58895102 CCCTCCCATCACAGGCCCTAAGG - Intronic
955516028 3:59727261-59727283 TGCTCCCTCCAGAGGTTCTGGGG - Intergenic
955654406 3:61229371-61229393 TGCTCCCTCAACAGGCTCTAGGG - Intronic
955813884 3:62821429-62821451 AGCTTCCTCCAAAGGCTCTAGGG + Intronic
956489838 3:69759132-69759154 TGTTGCGACCAGAGGCTCTAAGG - Intronic
957132061 3:76235416-76235438 CACTCCCTCCAAAGGCTTTAGGG - Intronic
957424853 3:80024326-80024348 CGCTCACTCCAAAGGCTCTAGGG - Intergenic
958060533 3:88474251-88474273 CCCTCCCATCACAGGCTCCAAGG + Intergenic
958650114 3:96927297-96927319 CCTTCCCATCATAGGCTCTAAGG - Intronic
959186994 3:103057170-103057192 CACTCCCACCAGATGCTAAAAGG + Intergenic
959583141 3:108002340-108002362 CATTCCCTCCAGAGGCTCTCGGG + Intergenic
959852003 3:111098403-111098425 TGTTCCCTCCAGTGGCTCTAAGG + Intronic
959888884 3:111532179-111532201 TGCTTCCTCCAAAGGCTCTAGGG - Intronic
961915400 3:130368953-130368975 CACTCCCACCTGAGGATCTGAGG - Intronic
962040982 3:131707236-131707258 CACTCTCTCCAGAGGCTTTAGGG + Intronic
963348666 3:144126436-144126458 TGCTCCCTTCAGAGGCTCTAGGG + Intergenic
963666042 3:148187563-148187585 TGCTCCCTCCAAAGGCTCTGAGG - Intergenic
964152760 3:153547780-153547802 GGCTACCATCAGAGGCTCTCTGG + Intergenic
964194167 3:154043230-154043252 GCCTCCCTCCAGAGGCTCTATGG + Intergenic
964426682 3:156561568-156561590 CCCTCCCATCATAGGCTCTGAGG + Intergenic
966278290 3:178201761-178201783 TGCTCCATCCAAAGGCTCTAGGG + Intergenic
966335881 3:178867627-178867649 TACTCCCACCAGAGGATTTAGGG - Intergenic
966452109 3:180074288-180074310 CGCTGCCACCACAGGCTCATTGG - Intergenic
968047053 3:195630381-195630403 TGCTCCCTCCAGAGGCTCCAGGG + Intergenic
968307596 3:197659663-197659685 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
969072088 4:4547649-4547671 CGCTCCCTTCAGAGACTCTAGGG - Intergenic
969078958 4:4603390-4603412 CACTCCCTCCAGAGGCTCCGGGG - Intergenic
969211810 4:5693536-5693558 CGCTCCCTCTGCAGGCTCTAGGG - Intronic
969256000 4:6002311-6002333 TGCTTCCTCCTGAGGCTCTAGGG - Intergenic
969604837 4:8197250-8197272 TGCTCCCTCCAGAAGCTCCAGGG - Intronic
969751876 4:9117655-9117677 CGCTCCCTCTGAAGGCTCTAGGG - Intergenic
969864320 4:10063839-10063861 GGCTCCTAGCAGAGGCGCTAAGG - Intergenic
969960455 4:10940003-10940025 CCCTCCCATCACAGGCTCAAAGG + Intergenic
970017629 4:11530615-11530637 CACTCCCTCCGGAGGCTCTAGGG + Intergenic
970695353 4:18670365-18670387 TGCTCCTTCCAGAGGCTCCAGGG - Intergenic
973631347 4:52823859-52823881 CACTCCCTCCAAAGCCTCTAGGG + Intergenic
973764761 4:54153004-54153026 CACTCTCTCCAAAGGCTCTAGGG - Intronic
974093303 4:57335083-57335105 TGCTCCTTCCAGAGACTCTAGGG - Intergenic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
975572570 4:75832812-75832834 TGCTCCCTCCGAAGGCTCTAGGG - Intergenic
976113834 4:81705701-81705723 CTCTCCCTCCAGAGGCTCTGGGG + Intronic
977100336 4:92803901-92803923 TGCTCTCTCCAAAGGCTCTAGGG + Intronic
977852619 4:101848238-101848260 CGCTTCCTCCAGAGGGTCTGTGG + Intronic
978644935 4:110918986-110919008 CGCTCCTTCTGGAGGCTCTAGGG + Intergenic
980501176 4:133656144-133656166 CACTCCCCCCAAAGGATCTAAGG + Intergenic
981541503 4:145851130-145851152 CACTCCTTCCAGAGGCTCTAGGG - Intronic
982217107 4:153091987-153092009 CGCTCCCTCCAGAGTCACTAAGG + Intergenic
982288028 4:153754858-153754880 TGCTCCCTCCAAAGACTCTAGGG - Intronic
982356384 4:154474026-154474048 TGCTCCCTCCAAGGGCTCTAAGG + Intronic
983886197 4:172983247-172983269 TGCTTCCTCCAGAAGCTCTAGGG - Intronic
985744562 5:1638760-1638782 TGCTCCCTCCAGAGGCTCCAGGG - Intergenic
985820367 5:2156048-2156070 CACTCCCTCCAGCGGCTCCAGGG + Intergenic
985936531 5:3101801-3101823 AGCTCCATCCAGAGGCTCCAGGG - Intergenic
985971280 5:3380644-3380666 CTCTCCCTCCAGGGGCTCCAGGG - Intergenic
986075866 5:4337582-4337604 CGCTCCCACCCCAGTCTCAAGGG - Intergenic
986139185 5:5013715-5013737 TGCTCCCTCCAGAGGCTCTGGGG - Intergenic
986348322 5:6854602-6854624 CATTCCCTCCAAAGGCTCTAGGG - Intergenic
986375214 5:7124296-7124318 CATTCCCTCTAGAGGCTCTAGGG + Intergenic
986615582 5:9613828-9613850 TGCTCCCACTAGAGGCTCTGAGG + Intergenic
986640653 5:9868563-9868585 CCCTCCCATCACAGGCTCTGAGG - Intergenic
986778741 5:11045080-11045102 TGCTCCCGCCTAAGGCTCTAGGG + Intronic
987282713 5:16426855-16426877 AGCTCCCACAAGAGGATCCAAGG + Intergenic
987371132 5:17194008-17194030 CACTGCCTCTAGAGGCTCTAGGG - Intronic
987667795 5:20967110-20967132 CACTCCCTCCAGATGATCTAGGG + Intergenic
988227050 5:28426258-28426280 CCCTCCCATCACAGGCTCCAAGG + Intergenic
988955389 5:36311202-36311224 TGCTCCCTCCATAGGCTCTAGGG - Intergenic
991429774 5:66531888-66531910 CATTCCCACAAGAGGATCTAAGG - Intergenic
992036381 5:72782620-72782642 CACTCCCATCATAGGCTCAAGGG + Intergenic
992464219 5:76987889-76987911 CACTCCCTCCAAAGGCTCCAGGG - Intergenic
992591799 5:78303352-78303374 CCCTCCCTCCAGAAGCTCTAGGG + Intergenic
992759961 5:79942854-79942876 TGCTCCCTCCAGAACCTCTAGGG + Intergenic
992779816 5:80117749-80117771 TGCTCCCTCCAAAGGATCTAGGG + Intronic
992970964 5:82057382-82057404 TGCTCCCACCAGAGGCTTTAGGG + Intronic
993081860 5:83310949-83310971 CACTCCCTCCGGAGGCTCGAAGG - Intronic
994018934 5:95001906-95001928 CCCTCCCACCACAGGCTCAGAGG + Intronic
994283457 5:97934839-97934861 CGCTCCCTCTAAAGGCTCCAGGG - Intergenic
994895641 5:105698346-105698368 CTCTCCCATCACAGGCCCTAAGG - Intergenic
996019845 5:118579006-118579028 CACACCCTCGAGAGGCTCTAGGG + Intergenic
996398182 5:123033952-123033974 AGCCCCCACCTGAGCCTCTATGG + Intronic
996933346 5:128917848-128917870 CACTCCCCACAGAGACTCTAGGG + Intronic
997606237 5:135177462-135177484 CTCTCTCACCTGAGGCTCTCAGG - Intronic
998291560 5:140920081-140920103 CACTCCCTTTAGAGGCTCTACGG - Intronic
998454262 5:142258771-142258793 CGCTCTCTCCGGAGGCTCCAGGG - Intergenic
998478904 5:142445104-142445126 TGCTCCCACCACAGGCCCCAGGG + Intergenic
999155230 5:149453150-149453172 CGCTCCCCCGAGAGGCTCTGGGG - Intergenic
1000624915 5:163527911-163527933 TGCTCTCTCCAGAGGATCTAGGG - Intergenic
1001250043 5:170140140-170140162 AGCTCCCTCCTGAGGCTCCACGG + Intergenic
1001283071 5:170401969-170401991 TGCTCCCTCCAAAGGCTCTAAGG + Intronic
1001633204 5:173191935-173191957 GGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1002208448 5:177580570-177580592 TGTTCCCTCCAGAGGTTCTAGGG - Intergenic
1002441995 5:179269201-179269223 TGCTCCCTCCAGAGGCTCCAGGG - Intronic
1002449902 5:179312779-179312801 CGCTCCCTCCGGAGCCTCTAGGG - Intronic
1002458775 5:179362069-179362091 CACTCCCTCCAGAGGCTTTGGGG + Intergenic
1003476742 6:6490614-6490636 CGCTTCCTCCAGTGGCTCCAGGG - Intergenic
1003646085 6:7913758-7913780 AGGTCCCTCCAGAGGCTCTGAGG - Intronic
1003671970 6:8167857-8167879 TACTCCCTCCACAGGCTCTAGGG + Intergenic
1004139926 6:13008974-13008996 AGATCCCTCCAGAGGCTCTTGGG + Intronic
1004333365 6:14741507-14741529 CGCTCCCTCCAAAGGTTCTGAGG - Intergenic
1004487828 6:16084167-16084189 CGCTCCATCCAGAGGCTCTAAGG + Intergenic
1005087513 6:22022118-22022140 AGCTCCTGCCAGAGGCTCTGGGG + Intergenic
1005105349 6:22218669-22218691 CCTTCCTTCCAGAGGCTCTAGGG - Intergenic
1005446724 6:25931631-25931653 TGCCCCCTCCAGAGGCTTTAGGG + Intergenic
1005708116 6:28477276-28477298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1006001140 6:30966043-30966065 GGCTTCCACCACAGGCTCTGAGG + Intergenic
1006271429 6:32969506-32969528 TGCTCCCTCCAGAGGCTCTGGGG - Intronic
1006620164 6:35358311-35358333 CACTTCCTCCAGAGGTTCTAAGG - Intronic
1006937688 6:37729779-37729801 TGCTCCCTCCAAAGGCTCCAGGG + Intergenic
1009661117 6:66612683-66612705 TTTTCCCACCAGAGGCACTAAGG + Intergenic
1010068093 6:71709725-71709747 CTCTCCCACCAGTTGCTCTGTGG - Intergenic
1010145945 6:72669566-72669588 CACTCCCACCACAGGCCCAAGGG - Intronic
1011011234 6:82705816-82705838 CCCTCCCATCAGAGGCCCAAAGG - Intergenic
1011163408 6:84418746-84418768 CACTCCCTCCAGAGGCTCTCAGG + Intergenic
1011464699 6:87643277-87643299 CGTTCCCAACAGAAGCTCTGGGG - Intronic
1011649544 6:89493233-89493255 TGCTCCCTCCAGAGTTTCTAGGG + Intronic
1011652085 6:89515997-89516019 TACTCCCTTCAGAGGCTCTAGGG - Intronic
1012205832 6:96459190-96459212 CACTCCCTCCAAAAGCTCTAGGG - Intergenic
1012227355 6:96719324-96719346 CGCTCCCTCCAAAGTTTCTAGGG - Intergenic
1012302489 6:97606603-97606625 CACTCCCTTCAAAGGCTCTAGGG + Intergenic
1013094885 6:106935683-106935705 TGCTCTCTCCAGGGGCTCTAAGG + Intergenic
1013480044 6:110545187-110545209 TGCTTCCTCCAAAGGCTCTAGGG + Intergenic
1015950683 6:138549524-138549546 TGCTCCCACCAGAGGCAGTATGG - Intronic
1016743843 6:147557435-147557457 TGCTGCCTCCAGAGCCTCTAGGG + Intronic
1016996779 6:149966514-149966536 AGCTCACACCTGAGGCTTTAAGG - Intronic
1017331943 6:153209549-153209571 TGCCCCCTCCAGAGGCTTTAGGG + Intergenic
1017788037 6:157772562-157772584 TGCTCTCCCCAGAGGCTCTGGGG - Intronic
1018045766 6:159965141-159965163 CGCTCCCTCTGAAGGCTCTAGGG + Intergenic
1018604813 6:165585633-165585655 CACACCCTCCAGAGGCTCGAAGG - Intronic
1018830458 6:167438578-167438600 CACTCCCCCCAGAGACTCTAGGG + Intergenic
1018830587 6:167439858-167439880 CACTCCCTCCAAAGGCTCTGGGG - Intergenic
1018836789 6:167491222-167491244 CGTTCCTTCCAGAGGCTCTAGGG + Intergenic
1019064751 6:169287849-169287871 TGCTCCCTCCAGAGGCTCCATGG + Intergenic
1019064761 6:169287880-169287902 TGCTCCCTCCAGAGGCTCCAAGG + Intergenic
1019064770 6:169287909-169287931 TGCTCCCTCCAGAGGCTCCATGG + Intergenic
1019064792 6:169287999-169288021 CGCTCCCTCCAGAGACTCCATGG + Intergenic
1019064820 6:169288109-169288131 TGCTCCCTCCAGAGACTCCATGG + Intergenic
1019841822 7:3453635-3453657 CTCTCCCTCTGGAGGCTCTAAGG - Intronic
1021816107 7:24449128-24449150 TGCTCCCTCCAGATGCTCTAAGG + Intergenic
1021915379 7:25426324-25426346 TGCTCCCTCCAAAGCCTCTAGGG + Intergenic
1023546126 7:41319204-41319226 AGCTCCCACCAGAGGATCTAGGG - Intergenic
1024037683 7:45522733-45522755 TGCTTTCTCCAGAGGCTCTAGGG + Intergenic
1024583766 7:50823445-50823467 CGCTCCCTCCAAAGGCTCCCGGG + Intergenic
1026634482 7:72069450-72069472 CACTCCCTCTGGAGGCTCTAGGG + Intronic
1026975060 7:74492752-74492774 TGCTCCCTCCAGAGGCTCTCGGG + Intronic
1028307398 7:89282853-89282875 CGCTTCCTTCAGAGGGTCTAGGG - Intronic
1028943503 7:96551859-96551881 GGTTCCTTCCAGAGGCTCTAGGG - Intronic
1029317305 7:99726260-99726282 CCATCCCACAAGAGGCTTTAAGG + Intronic
1031029090 7:116715294-116715316 TGCTCCCTCTGGAGGCTCTAGGG + Intronic
1031729963 7:125287995-125288017 TGCTCCCTCCGAAGGCTCTAAGG + Intergenic
1031967434 7:128037197-128037219 CACTCCCTCCAGAGGCCGTAGGG + Intronic
1032593871 7:133219420-133219442 CGCTCCTTCTGGAGGCTCTAGGG + Intergenic
1032890038 7:136184160-136184182 GGCTCCCTCCAGAGGTTCTAAGG - Intergenic
1033189660 7:139265820-139265842 TGGTCCCTCCAGAGGCTCTAGGG - Intronic
1033400294 7:141016490-141016512 TGTTCCCTCCAGAGACTCTAGGG + Intergenic
1034230448 7:149522429-149522451 CACTCCCACCATAGTCCCTAGGG + Intergenic
1034341741 7:150361620-150361642 CACTCCCTCCAAAGTCTCTAGGG - Intergenic
1034538101 7:151738379-151738401 TGCTCCCAACAGAGGCCCCATGG - Intronic
1034964216 7:155381752-155381774 CGCCCGCTCCCGAGGCTCTAGGG + Intergenic
1035759491 8:2059025-2059047 TCCTCCCGCCTGAGGCTCTAAGG + Intronic
1036973776 8:13385096-13385118 CGCTCCCACCATGCACTCTAGGG - Intronic
1037108353 8:15137475-15137497 CCCTCCCATCACAGGCCCTAAGG + Intronic
1037532599 8:19792179-19792201 AGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1038062076 8:23924981-23925003 CACTCCCTCTGGAGGCTCTAGGG + Intergenic
1039965913 8:42283627-42283649 TGCTCCATCCAGAGGCTCTAGGG - Intronic
1040891132 8:52317423-52317445 TGCTCCCTCCGAAGGCTCTAGGG - Intronic
1041017843 8:53609313-53609335 CGCTCACACCAGAGACTTGATGG + Intergenic
1042113265 8:65404239-65404261 TGCTCCCTCCAAAGCCTCTAAGG - Intergenic
1042295754 8:67215701-67215723 CATTCCCTCCAAAGGCTCTAAGG - Intronic
1042781150 8:72492240-72492262 TGCTTCCTCCAAAGGCTCTAGGG - Intergenic
1043596351 8:81890619-81890641 CACTCCCTCTAGAGGCTCTAGGG + Intergenic
1043927959 8:86059430-86059452 TGTTCCTTCCAGAGGCTCTAGGG + Intronic
1044618574 8:94166878-94166900 CGTTCCCTCCAGAGTCTCAAGGG - Intronic
1044634549 8:94309497-94309519 TGCTTCCTCCAGAGACTCTAAGG - Intergenic
1044726846 8:95201349-95201371 CGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1044727749 8:95207199-95207221 CCCTCCCTCCGGAGGCTCCAGGG - Intergenic
1044728791 8:95213968-95213990 CACTCCCTCCAAAGCCTCTAGGG - Intergenic
1044929682 8:97239940-97239962 CCCTCCCTCCAAAGGCTCCAGGG + Intergenic
1046675390 8:117102601-117102623 TGCTCACTCCAAAGGCTCTAGGG + Intronic
1047303443 8:123634570-123634592 CATTCCCTCCAGAGGCTCTAGGG + Intergenic
1047971538 8:130088587-130088609 TGCTCCCTCCAGAGGCCCTGTGG - Intronic
1048035221 8:130671516-130671538 TGCTCTCTCCAGAGGCTCTAGGG - Intergenic
1048316448 8:133366491-133366513 TGCTCCCTGCAGAGGGTCTAGGG - Intergenic
1049151206 8:141036623-141036645 CGCTGCCGCCAAAGGCTCTGGGG + Intergenic
1049631169 8:143658437-143658459 CTCTCCCATCAGAGGCTCAGAGG - Intergenic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1051037840 9:12770390-12770412 TGCTCCCTCCAAAGCCTCTAGGG - Intergenic
1051642624 9:19238023-19238045 TGCTCCCACTGTAGGCTCTAGGG + Intronic
1051766340 9:20528540-20528562 CGCTCCCCACAAAGGCTCTAGGG + Intronic
1052127716 9:24798404-24798426 TGCTCCCTCCAAAGGCTCTAGGG + Intergenic
1053268117 9:36730750-36730772 TGCTCTCTCCACAGGCTCTAAGG + Intergenic
1053564728 9:39237093-39237115 TGCTGCCTCCGGAGGCTCTAGGG + Intronic
1053567542 9:39269048-39269070 CACTCCCTACGGAGGCTCTAGGG - Intronic
1053830509 9:42074994-42075016 TGCTGCCTCCGGAGGCTCTAGGG + Intronic
1054129601 9:61349950-61349972 CACTCCCTACGGAGGCTCTAGGG + Intergenic
1054132423 9:61381941-61381963 TGCTGCCTCCGGAGGCTCTAGGG - Intergenic
1054600051 9:67112461-67112483 TGCTGCCTCCGGAGGCTCTAGGG - Intergenic
1055385394 9:75756802-75756824 GGCTTCCTCCAGAGGCTATAGGG - Intergenic
1055768074 9:79686694-79686716 TGCTCCCTCCAAAGGCTCCAGGG - Intronic
1056107512 9:83361917-83361939 TGCTCCCTCCGAAGGCTCTAGGG - Intronic
1056306701 9:85297933-85297955 CACTCCCTCCAGAGGCTCCAGGG + Intergenic
1056491659 9:87114073-87114095 CGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1056743024 9:89276266-89276288 CCCTCCCATCACAGGCTCTGAGG - Intergenic
1056996165 9:91461543-91461565 CACTCCCTCCGGAGGCTCTTGGG + Intergenic
1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG + Intergenic
1057742074 9:97720656-97720678 TACTCCCTCCTGAGGCTCTAGGG - Intergenic
1057792709 9:98134659-98134681 AGCTCCCTCCAGATGCCCTAGGG - Intronic
1057967455 9:99517967-99517989 CACTCCCTCCAGAGGCTCTAGGG - Intergenic
1058634247 9:107020956-107020978 AGCTCACACCACAGGCTCTGGGG + Intergenic
1058766297 9:108185751-108185773 TGCTCTCTCCAGAGGCTCTAGGG + Intergenic
1059108524 9:111532542-111532564 TGCTCCCTTCAGAGGCTCTGGGG - Intronic
1060273913 9:122167811-122167833 CATTCCATCCAGAGGCTCTACGG + Intronic
1061044264 9:128156160-128156182 TGCTTCCTCCAGAGGCTCTCAGG + Intergenic
1061939465 9:133876339-133876361 CGCTGCCAGCAGAGGCGCTGTGG + Intronic
1061955630 9:133959869-133959891 CCCTCCCTCCAGAGGCACTAGGG - Intronic
1062073421 9:134571646-134571668 GGCTCCTCCCAGAGGCTCTGGGG + Intergenic
1062151271 9:135020408-135020430 TGCTCCCTCCAGAAGCTCTAGGG - Intergenic
1062158626 9:135067654-135067676 TCCTCCCTCCAGAGGCTCTAGGG - Intergenic
1062213171 9:135375427-135375449 CCCTCCCACCGAAGGCTCTGCGG - Intergenic
1062445538 9:136592602-136592624 CGCTCCCTCCAGAGGCTCCAGGG - Intergenic
1062705115 9:137934540-137934562 CGCTTCCTTCAGAGGGTCTATGG - Intronic
1185484854 X:474568-474590 CAGTCCCTCCAGAGGTTCTAGGG + Intergenic
1185484911 X:474925-474947 AGCTCCCTCCAGAGGCCCTAGGG + Intergenic
1185499754 X:587843-587865 TCCTCCCATCAGAAGCTCTAGGG + Intergenic
1185511239 X:666553-666575 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
1185511260 X:666642-666664 TGCTCCCTCCAGAGGCTCTAAGG - Intergenic
1185511301 X:666820-666842 TGTTCCCTCCAGAGGCTCTAAGG - Intergenic
1185523868 X:761888-761910 TGCTCCCTCCACAGTCTCTAGGG + Intergenic
1185548464 X:965233-965255 AGCTCCCTCCACAGGCTGTAGGG + Intergenic
1185586753 X:1246734-1246756 TGCTCCCTCTGGAGGCTCTAGGG - Intergenic
1185614793 X:1414222-1414244 TGCTCCCTCTGGAGGCTCTAGGG - Intronic
1185621952 X:1455440-1455462 CGCTCCCTCCGAAGGCTCTAGGG + Intergenic
1185622753 X:1463695-1463717 AGTTCCCTCCAGAGACTCTAGGG + Exonic
1185650476 X:1644145-1644167 CATTCCCTCCAGAGGCTCTAGGG - Intergenic
1185653508 X:1666383-1666405 TGCTCCCTCTGGAGGCTCTAGGG + Intergenic
1185653673 X:1667403-1667425 GGTTCCCTCCAGAGGCTCTAGGG + Intergenic
1185653716 X:1667717-1667739 AGCTCCCTCCGGAGGCTCTGGGG + Intergenic
1185655794 X:1684541-1684563 TGCTTCCTCCGGAGGCTCTAGGG - Intergenic
1185677086 X:1857893-1857915 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1185677316 X:1859467-1859489 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185680386 X:1884213-1884235 TGCTCCCTCCAGAGACTCTAGGG + Intergenic
1185680436 X:1884554-1884576 AGTTCCCTCCAGAGGCTCTCAGG + Intergenic
1185683507 X:1908404-1908426 CACACCCTCCGGAGGCTCTAAGG + Intergenic
1185691007 X:2155276-2155298 TGCTCCCTCCGGAGGCTCTAGGG + Intergenic
1185704943 X:2260017-2260039 AGTTCCCTCCAGAGGCTCTAGGG + Intronic
1185710319 X:2298207-2298229 AGCTCCATCCAGACGCTCTAGGG - Intronic
1185764602 X:2715360-2715382 TGCTCCCTCTAGGGGCTCTAGGG + Intronic
1185792695 X:2939317-2939339 TGTTCCCGCCAGAAGCTCTAGGG - Intronic
1185794202 X:2950848-2950870 TACTCTCTCCAGAGGCTCTAGGG + Intronic
1185888361 X:3802434-3802456 CGCTCCCTCCGAAGGCTCTAGGG - Intergenic
1186274341 X:7923412-7923434 CACTCTCTCCAGAGGCTCCAGGG - Intronic
1186966457 X:14791403-14791425 CACTCCCTCCAGAGGTGCTAGGG - Intergenic
1187563489 X:20425058-20425080 TGCTCCCTCCAAGGGCTCTAGGG + Intergenic
1188390949 X:29618500-29618522 TGCTCCCTCCGGAGGATCTAGGG + Intronic
1189188598 X:39075474-39075496 CCCTCCCCCTGGAGGCTCTAGGG - Intergenic
1190097667 X:47494834-47494856 TGCTCCCACCAGAGGCTGCCAGG + Intergenic
1190891076 X:54568434-54568456 CACTCTCTCCAGAGACTCTAGGG + Intergenic
1192222937 X:69209806-69209828 TGCTCCTTCCAGAGGCTCTAAGG - Intergenic
1192498433 X:71632337-71632359 TGCTCCCTCCAGAAGCTCTAGGG + Intergenic
1193741625 X:85224165-85224187 CGCTCCCTCCAGAGGCTCTAGGG + Intergenic
1193827250 X:86241701-86241723 CCCTCCCATCACAGGCCCTAAGG + Intronic
1195554908 X:106210688-106210710 CCCTCCCATCACAGGCTCAAAGG - Intergenic
1195664575 X:107417129-107417151 CGATCCCTCTAGGGGCTCTAGGG - Intergenic
1195958823 X:110364085-110364107 TGCTCCCTACAAAGGCTCTAGGG + Intronic
1196120507 X:112045381-112045403 CACTACCTCCAGAGGCTCTAGGG - Intronic
1196168958 X:112565938-112565960 CCCTCCCATCAGAGGCCCTGAGG - Intergenic
1197708942 X:129652846-129652868 TGCTCCCCCCAGAGGCTGTGGGG - Intronic
1197719122 X:129733071-129733093 CCCTCCCATCACAGGCTCTGAGG + Intergenic
1198211327 X:134519109-134519131 TGCTCCCTCCAAAGGCTTTAGGG + Intronic
1198642210 X:138768882-138768904 CTCTTCCCTCAGAGGCTCTAGGG - Intronic
1198687671 X:139244752-139244774 CACTTCCTCCAGAGGCTCTAGGG - Intergenic
1199460189 X:148075526-148075548 TGCTCCCTCCAAAGGTTCTAGGG - Intergenic
1199982115 X:152926868-152926890 TGCTCCCTCCAAAGGCTCTGGGG + Intronic
1200041660 X:153375312-153375334 CACTCCCCCCAGAGGCTCTAGGG - Intergenic
1200050982 X:153431602-153431624 CGCTCCCTCCAGAGGCTCTAGGG - Intergenic
1200067861 X:153513130-153513152 CACTCCCCCCAGAAGCTCTAGGG + Intergenic
1200246818 X:154530889-154530911 CACTCCCGCCAGAGGCCCAAGGG - Intergenic
1200354500 X:155534235-155534257 CACTCCCACCACAGGCCCAAGGG + Intronic
1201620644 Y:15953310-15953332 AGTTCCCTCCAGAGGCTCTAGGG - Intergenic
1201639296 Y:16161594-16161616 CTCTCCCTCCACAGGCTCCAAGG - Intergenic
1201663517 Y:16423733-16423755 CTCTCCCTCCACAGGCTCCAAGG + Intergenic