ID: 1184473588

View in Genome Browser
Species Human (GRCh38)
Location 22:44709177-44709199
Sequence GGTGGTGGGGAGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184473588_1184473593 -5 Left 1184473588 22:44709177-44709199 CCTGCTTGTGGCTCCCCACCACC 0: 1
1: 0
2: 3
3: 24
4: 296
Right 1184473593 22:44709195-44709217 CCACCCCTGCCTGCTTGCTCTGG 0: 1
1: 0
2: 3
3: 49
4: 503
1184473588_1184473594 -4 Left 1184473588 22:44709177-44709199 CCTGCTTGTGGCTCCCCACCACC 0: 1
1: 0
2: 3
3: 24
4: 296
Right 1184473594 22:44709196-44709218 CACCCCTGCCTGCTTGCTCTGGG 0: 1
1: 0
2: 2
3: 31
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184473588 Original CRISPR GGTGGTGGGGAGCCACAAGC AGG (reversed) Intronic
901842813 1:11964551-11964573 GGTGGTGGGGAGTCATAGCCTGG - Intronic
902104988 1:14027476-14027498 GGTGGCGGGGGGGCAGAAGCCGG - Intergenic
902260880 1:15223910-15223932 GGGGAAGGGGAGCCACGAGCAGG + Intergenic
902419418 1:16266628-16266650 GGTAGTGAGGAGCCTCAAACTGG + Intronic
902885596 1:19402615-19402637 GGTGGTGGGAAGGTACTAGCTGG - Intronic
902894462 1:19469216-19469238 GGGAAGGGGGAGCCACAAGCTGG + Intronic
903311986 1:22465796-22465818 GTTCTTGGGGAGCCAGAAGCAGG - Intronic
903647763 1:24905139-24905161 GGTGGTGGGGTGTCCCAAGGGGG + Intronic
903927571 1:26841579-26841601 GTGAGTGGGGAGCCAAAAGCTGG + Intronic
904260513 1:29285027-29285049 GGTGGTGGGAAGCCAGAGACTGG + Intronic
906497642 1:46316843-46316865 GGGGGTGGGGAGCGGCAAGGAGG + Intergenic
907424279 1:54369307-54369329 GGGGGTGGGGGGGCACAAACTGG + Intronic
907865767 1:58397734-58397756 GGTGGTGGGGAGCAATAAAGGGG - Intronic
911150378 1:94592481-94592503 GGTGGATGGGAGCTACAATCTGG - Intergenic
912314010 1:108650320-108650342 GGTGTCGGGGAACCACCAGCTGG - Exonic
913070014 1:115290197-115290219 AGTGGTGGGGAAGCTCAAGCAGG - Intronic
913644750 1:120845178-120845200 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914081977 1:144418405-144418427 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914099127 1:144568424-144568446 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914176884 1:145286905-145286927 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914299860 1:146369240-146369262 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914531612 1:148528397-148528419 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914636779 1:149559332-149559354 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
915227043 1:154419001-154419023 GGTGGTGGGGAGCCCAGAGAAGG + Intronic
916960715 1:169885863-169885885 TGTGGTGGGGAGCAAGTAGCTGG + Intronic
917456895 1:175193107-175193129 GGGAGTGGGGAGCCACCGGCGGG - Intergenic
919730878 1:200912956-200912978 GGAAGTGGGGAGCCACACACAGG + Intronic
919808184 1:201393115-201393137 GGTAGTGGGGAGGGACAAGAAGG + Intronic
921961575 1:221040757-221040779 GATGTTGGGGAGCTACATGCTGG + Intergenic
922476096 1:225907791-225907813 GGTGGAGTGGAGCCTCCAGCTGG - Intronic
922695067 1:227727031-227727053 GGTCTTGGGCAGCCACAAGACGG - Intergenic
922753178 1:228080484-228080506 GGTGGTGGGGAGCCCAAACCAGG + Intergenic
922988636 1:229886324-229886346 CGTGGTGGGGAACCCCACGCAGG - Intergenic
923696146 1:236254443-236254465 GGTGATGGGAAGCCACAGGAAGG - Intronic
923855164 1:237838507-237838529 GATGGAGGGAAGACACAAGCTGG + Intergenic
1063219786 10:3956306-3956328 AGTGGTGGGGAGGGACAAACGGG + Intergenic
1063566799 10:7178162-7178184 GGTGGTGGGGAGGTGCAGGCAGG - Intronic
1064028215 10:11866368-11866390 GGTGATGGAGAGGCACACGCAGG + Intronic
1064201739 10:13290411-13290433 GGTGTTCGGGAGCCACACTCAGG - Intronic
1064527699 10:16275136-16275158 AGTGGTGGGGAGCCACCAAAAGG + Intergenic
1066461790 10:35619027-35619049 AGCAGTGGGGAGCCACAGGCTGG - Intergenic
1067038193 10:42934235-42934257 GCTGGTGGGCAGCCATAAGGAGG - Intergenic
1067765365 10:49081767-49081789 GTGTGTGGGGAGCCACACGCAGG - Intronic
1068849623 10:61721697-61721719 GGTGAAAGGGAGCCACAAGCAGG - Intronic
1069564107 10:69451719-69451741 GGGGGTGGGGACCCACAATCCGG + Intronic
1069824288 10:71245787-71245809 TCAGGTGGGGTGCCACAAGCTGG + Intronic
1072148596 10:92666533-92666555 GGGGGTGGGGAGACACAATTAGG - Intergenic
1075084508 10:119405546-119405568 GGGGGTGGGGAGCCAGAGGAGGG - Intronic
1075345326 10:121677969-121677991 TGGGGAGGGGAGCCACAACCAGG + Intergenic
1076164026 10:128267913-128267935 GGTGGTGGGGAGCAAGGAACAGG + Intergenic
1076258994 10:129050837-129050859 GGTGATGGGGAGCAGGAAGCTGG + Intergenic
1076824537 10:132960435-132960457 GCAGGTGGGGACCCACAATCAGG + Intergenic
1077678536 11:4219045-4219067 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1077682094 11:4251287-4251309 GGTGCTGGGGAGTCAGAGGCTGG + Intergenic
1077687939 11:4315448-4315470 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1080399799 11:31923252-31923274 GGTTGTGGTGAGCCACAATCGGG - Intronic
1081716110 11:45251762-45251784 GCTGTTGGGGGGCCACAAGTGGG - Intronic
1081864222 11:46350894-46350916 GGTGGGAGGAATCCACAAGCTGG - Intronic
1082810592 11:57476884-57476906 GGTGGTGGGGCACCAGGAGCAGG - Exonic
1083712453 11:64557568-64557590 GGTGCTGAGGGGCCAGAAGCAGG + Intronic
1084223032 11:67696584-67696606 GTTGGTGGGAAGCCTGAAGCAGG - Intergenic
1085021898 11:73215368-73215390 CATGGTGGGGAGCCAGAAGCAGG + Intergenic
1089261373 11:117226081-117226103 GGAGGTGGGGAGCCATATGTGGG + Intronic
1089407087 11:118206707-118206729 GGAGGTGGAAAGCCAGAAGCAGG - Intronic
1090334373 11:125953050-125953072 GGAGGTGGGGGGCCACTAGTGGG + Intergenic
1091205224 11:133816363-133816385 GGTGGTGAGGAGACACATCCAGG - Intergenic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1092140166 12:6178326-6178348 GATGGTGGGAGGCCACTAGCAGG - Intergenic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1092238647 12:6824559-6824581 GGTGGTGGGGGGACCAAAGCGGG + Exonic
1092256377 12:6928441-6928463 GGGGGTGGGGAGCCGCAGGCCGG - Intronic
1094218531 12:27970414-27970436 AGTGGAGGGGAGCCCCGAGCCGG + Intronic
1096177907 12:49535201-49535223 CGTGGTGGGGAGTCACAGGGAGG - Intergenic
1096478022 12:51920607-51920629 GGTAATGGGGAGACATAAGCAGG - Intronic
1097395114 12:59063958-59063980 GGTTGTGTGGAGCCTCAACCTGG + Intergenic
1099974244 12:89529704-89529726 TGTGGGTGGGAGCCACAAGCAGG + Intergenic
1101433111 12:104643358-104643380 GGTGGTGAGGAGCAACAACAAGG - Intronic
1102216919 12:111168200-111168222 TGAGGTGAGGAGCCACAAACTGG - Intronic
1102471084 12:113160272-113160294 GGAGGTGGAGGGACACAAGCAGG + Intronic
1103562795 12:121800866-121800888 GGTCGTGGGGAGCCCGGAGCAGG - Intronic
1104498839 12:129265660-129265682 GGTGTTGAGGAGCCCCAAGCAGG - Intronic
1104623109 12:130333107-130333129 GGTGGTTGGGATCCCCAAGTCGG + Intergenic
1105997275 13:25685062-25685084 GTTGGGGAGGAACCACAAGCAGG - Intronic
1106466865 13:30021291-30021313 GGTGGTGGGAAGACACCAGGTGG - Intergenic
1107389067 13:39944537-39944559 GGTGGTGAGGTGGCACAAGGAGG - Intergenic
1108630724 13:52279296-52279318 GGTGGGGTGGCGCCACCAGCAGG + Intergenic
1108655962 13:52533244-52533266 GGTGGGGTGGCGCCACCAGCAGG - Intergenic
1108962141 13:56247414-56247436 GGTGGGGTAGAGCAACAAGCAGG - Intergenic
1109703729 13:66061194-66061216 GGTGTTGGGGATACACAATCGGG - Intergenic
1112221507 13:97495702-97495724 GGTCGGGGGGAGCCAGAAACTGG - Intergenic
1113043050 13:106125327-106125349 TGAGGTGAGGAGCCACAGGCAGG - Intergenic
1113372743 13:109737842-109737864 GGAGGTGGGGTGCCCCAAGCAGG - Intergenic
1119401000 14:74362295-74362317 GTTGGTGGGGAGAAATAAGCCGG - Intergenic
1119421450 14:74510029-74510051 GAGGGGAGGGAGCCACAAGCTGG + Intronic
1119793588 14:77376529-77376551 TAGGGTGGGGAGCCAGAAGCAGG + Intronic
1119918640 14:78426018-78426040 GGTTGTGGGTAGCCAGGAGCAGG + Intronic
1121472713 14:94167664-94167686 GGAGGTGGGGAGCAATAAACTGG - Intronic
1122836737 14:104434344-104434366 GGTGGCGGGTGGCGACAAGCAGG - Intergenic
1124594703 15:31082972-31082994 GGTGGGGGCGACCCACAAGGAGG + Intronic
1125376815 15:39039053-39039075 AGAGGTGGGGAGACACAAGATGG - Intergenic
1126471482 15:49016202-49016224 GGTTGTGGGGAGGGAAAAGCAGG + Intronic
1127319298 15:57826977-57826999 GGTGGGGAGCAGCCACAACCTGG - Intergenic
1127791915 15:62405715-62405737 GCTGGTGGGGAACCAGAAGCTGG + Intronic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1128992596 15:72272913-72272935 AGTGGTTGGGAGGAACAAGCAGG + Intronic
1129888504 15:79055616-79055638 GGTGTTGGGGAGCAGAAAGCAGG - Intronic
1130061395 15:80572580-80572602 GGTGGTGGGGAACCCCATGGAGG - Intronic
1132814422 16:1818967-1818989 GGTGCTGGGGAGCCTCATGGTGG - Intronic
1133129166 16:3665638-3665660 GGGGCTGGGGAGCCACAGACAGG - Intronic
1133303158 16:4795370-4795392 GGTGGTGTGGAGCCGGAAGCAGG + Intronic
1133460619 16:5983675-5983697 GGTGTGGGGAAGCCCCAAGCAGG - Intergenic
1134677253 16:16099352-16099374 GGTGGTGGGGACCCTGAAGAGGG + Intronic
1136078094 16:27830654-27830676 GGGGGTGGTGAGTCACATGCTGG - Intronic
1136429111 16:30186727-30186749 GGTGGTGGGGACCCAGGGGCTGG + Intronic
1136544227 16:30946975-30946997 GGCCGTGGGGATCCACAGGCTGG - Intronic
1138121791 16:54406027-54406049 GGTGGTGAGGAGCAACCAGGGGG + Intergenic
1138460009 16:57142538-57142560 GGCGGTGGGGAGCCACTGGAAGG + Intronic
1139588229 16:67917938-67917960 AGTGGTGGGGAGACACAGGTTGG + Intronic
1139946776 16:70647277-70647299 GGTGTTGGGGAGCCCCGGGCGGG + Intronic
1140395987 16:74627385-74627407 GGTGGAGGGGAGGGACAAGTGGG - Intronic
1140742306 16:77952443-77952465 GGTGGTGGGGGGTCACAGGGAGG - Intronic
1141775776 16:86121807-86121829 AGAGGTGGGGAGGGACAAGCAGG - Intergenic
1142028243 16:87825692-87825714 GGGGGTGGGGAGTCACGGGCTGG - Intergenic
1143326921 17:6105100-6105122 GCTGGCGGGGATCCACATGCGGG - Intronic
1143591742 17:7889232-7889254 TGGAGTGGGGAGACACAAGCTGG - Intronic
1144466586 17:15502289-15502311 GGGGGTGGGGGGGCACAAGAGGG + Exonic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1148818282 17:50346167-50346189 GCTGGTGCGGCGCTACAAGCTGG + Exonic
1152076134 17:78161103-78161125 GGTGGTGAAGACCCACGAGCCGG + Exonic
1152387671 17:79984872-79984894 GGTGGGGGGGAGCCAGAGGGAGG - Intronic
1153351366 18:4084038-4084060 GATGGATGGGAGCCAGAAGCGGG + Intronic
1153753953 18:8261253-8261275 GGGGGTGGGGAGGCACTGGCAGG + Intronic
1153959696 18:10130437-10130459 GGTGGTGGGGAGACACAGGCAGG - Intergenic
1157157274 18:45280384-45280406 GGTGTTAAGGGGCCACAAGCAGG + Intronic
1157248032 18:46071226-46071248 GGTGGTGGGGGGAGGCAAGCAGG + Intronic
1157514855 18:48303640-48303662 GGTGGAGGGGAGCAATAGGCTGG + Intronic
1157573045 18:48725510-48725532 GGTGGTGGGAAGGCAGAAGGTGG - Intronic
1157701835 18:49766046-49766068 TGGGGTGGGGTGGCACAAGCTGG - Intergenic
1160584314 18:79904180-79904202 GATGCTGTGGAGACACAAGCAGG + Exonic
1160690316 19:458413-458435 GGTCCTGGGGAGGCAGAAGCGGG + Intronic
1160690482 19:458857-458879 GGTCCTGGGGAGGCAGAAGCCGG + Intronic
1160966965 19:1750898-1750920 GCTGGTGGGGAGAAGCAAGCTGG + Intergenic
1161069224 19:2252171-2252193 GGTGGTGGGGCGCTTCAGGCAGG - Intergenic
1161334453 19:3705077-3705099 GGTGGTGGGAGGGCACAATCTGG + Intergenic
1161577006 19:5059910-5059932 GGTGGGAGTGAGCCACACGCAGG - Intronic
1162018098 19:7856495-7856517 CATGGTGGGGAGCCACAGCCCGG + Intronic
1162069815 19:8147062-8147084 GGAGGTGGGGGGGCACAGGCCGG - Intronic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163088773 19:15003405-15003427 GATGGTGGGAAGCCCCAGGCTGG - Intronic
1163273396 19:16267604-16267626 GCTGGGGAGAAGCCACAAGCAGG + Intergenic
1163760651 19:19134719-19134741 GGGCGTGGGGAGCCAGAAGGGGG + Intronic
1164120596 19:22261878-22261900 GCGGGTGGGGAGGGACAAGCGGG + Intergenic
1164160543 19:22623274-22623296 GCTGGTGGGGAGGGACCAGCGGG + Intergenic
1164832967 19:31336744-31336766 GCTGGTGAGGAGGCACAGGCTGG - Intronic
1165806371 19:38583555-38583577 TGGGCTGGGGAGCCACAAGAAGG - Intronic
1166735085 19:45079290-45079312 GGTGGTGGGGGGTCGCCAGCAGG + Exonic
1167517042 19:49929477-49929499 GGGGGTGGGGAGTCGCGAGCGGG + Exonic
1167602954 19:50465158-50465180 GGCGGTGGGGAGTCCCCAGCGGG - Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
926088715 2:10036378-10036400 GGAGGTGGGGAGGCCCAAGCCGG - Intergenic
927448735 2:23188248-23188270 GGTTGACAGGAGCCACAAGCAGG + Intergenic
927653678 2:24928077-24928099 GGTGGTGAGGAACCACAGGTGGG - Intergenic
928123678 2:28601968-28601990 GGTGGGGGGCTTCCACAAGCTGG + Intronic
928854765 2:35790206-35790228 GGTGGTTGTGTGCCATAAGCTGG + Intergenic
929464269 2:42130732-42130754 GGTGGTGGGGGGCCAAAAAAAGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
933807708 2:86012164-86012186 GGGGGCGGGGAGACCCAAGCAGG - Intergenic
933902570 2:86860623-86860645 GGTTTTGGGGTCCCACAAGCTGG - Intronic
935777977 2:106488645-106488667 GGTTCTGGGGTCCCACAAGCTGG + Intergenic
937923550 2:127149859-127149881 GGTTGTGGTGAGCCAAAATCAGG - Intergenic
942362545 2:175187597-175187619 GGTGATGGGGAGACACTAGGAGG - Intergenic
944670376 2:201989396-201989418 TGTGGTGGGAAGCCATAAGGAGG + Intergenic
946192032 2:218012625-218012647 GGGGGTGGGGGGCCAGAAGTTGG - Intergenic
946408225 2:219503838-219503860 GGTGGTGGGGAGGATCAGGCAGG + Intronic
946493489 2:220172293-220172315 GGTGGTAGGGAGAGGCAAGCAGG - Intergenic
947591773 2:231389976-231389998 GGTGGGGAGGAGCCGCAGGCTGG - Intergenic
947666561 2:231909697-231909719 GGGGGTGGGGAACCAGATGCCGG - Intergenic
947913963 2:233819985-233820007 GGTGGTGGTGCGCCAGCAGCAGG - Exonic
948615949 2:239199097-239199119 GGTGGTGGGGGGCAGGAAGCAGG - Intronic
1170429249 20:16261482-16261504 GGTGGGGGGAATCCTCAAGCTGG + Intergenic
1170668397 20:18406717-18406739 AGTGGGGGAGAGCAACAAGCAGG + Intronic
1170693663 20:18638028-18638050 CGTGATGGGGAGCCAAAGGCAGG - Intronic
1170877050 20:20259712-20259734 GGTGGTCAGGAGATACAAGCAGG - Intronic
1173134634 20:40428653-40428675 AGTGTGGGGGAGCCACAGGCTGG - Intergenic
1173528355 20:43749943-43749965 AGTGGCCGGGAGCCGCAAGCCGG - Intergenic
1174173599 20:48631714-48631736 GGAGGTGGTGAGACACACGCAGG + Intronic
1174295108 20:49540172-49540194 GGTGCTGGGGAGCAGCAAGGAGG + Intronic
1174714163 20:52739024-52739046 GTGGGTGGGGAGACACAAGCTGG - Intergenic
1175630144 20:60528793-60528815 GGTGAGGGGGAGAGACAAGCAGG - Intergenic
1175970665 20:62685166-62685188 GGTGGTGGGGAGGCACGGGCAGG + Intronic
1176448238 21:6840360-6840382 CGTGGTGCTGAGCCGCAAGCTGG + Intergenic
1176826408 21:13705382-13705404 CGTGGTGCTGAGCCGCAAGCTGG + Intergenic
1178183978 21:30198378-30198400 GGAGGTGGGTAGCCAGAAGTAGG + Intergenic
1178532898 21:33389897-33389919 GGAGGTGGGGAGCCCCTGGCAGG - Intergenic
1180141303 21:45895083-45895105 GGTGGACGGGAGCCACAGCCAGG - Intronic
1180790107 22:18571195-18571217 GGTGGTGTGGGGACACAGGCAGG - Intergenic
1180945754 22:19692242-19692264 GGTGGGTGGGAGCCCCAGGCAGG - Intergenic
1181231632 22:21424120-21424142 GGTGGTGTGGGGACACAGGCAGG + Intronic
1181247019 22:21510748-21510770 GGTGGTGTGGGGACACAGGCAGG - Intergenic
1182713823 22:32339608-32339630 GGAGGTGGGGAGCCACCAGGTGG + Intergenic
1182868348 22:33624582-33624604 GGCAGAGGGGAGCTACAAGCAGG + Intronic
1183183537 22:36278006-36278028 GGAGGTGGCGAGCTTCAAGCTGG + Intergenic
1183438025 22:37806599-37806621 GGTGGTAGGGAGCAGCCAGCCGG + Exonic
1184473580 22:44709154-44709176 GGTGGTGGGGAGCCGAACACAGG - Intronic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1185380265 22:50504661-50504683 GCTGGTGGGGCACCACAACCGGG + Exonic
950090458 3:10290961-10290983 GGTGGCGGGGTGCCCCAAGTGGG + Exonic
950202820 3:11056975-11056997 GGTGGTGGGGAGCCATGGGAAGG - Intergenic
952790477 3:37196582-37196604 GGTGGAGGTCAGCCACCAGCAGG - Intergenic
954418927 3:50408368-50408390 GCTGGTGGGCAGCGACAAGGTGG - Intronic
954426690 3:50447145-50447167 GGGGGAGGGGATCCACTAGCAGG + Intronic
954481293 3:50803827-50803849 GGTGGGGGGCAGCCCCAACCCGG - Intronic
954682566 3:52353630-52353652 GCAGGTGGGTAGCCACCAGCGGG + Exonic
954697784 3:52436789-52436811 GGAGGAGGGGAGCAACAAGATGG - Intronic
956114214 3:65902602-65902624 AGTGGGAGGGAGCCACAGGCTGG - Intronic
957491285 3:80930975-80930997 GGGGGTGGGGGGCTACAAGAGGG - Intergenic
958001955 3:87761833-87761855 GGAGATGGGGAGCCAGAAGGGGG + Intergenic
961176649 3:124841266-124841288 AGTGGTCAGGAGCCACATGCTGG + Intronic
961650689 3:128415369-128415391 GGTGGGGTGGAGCCTCAGGCAGG + Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
969689718 4:8697868-8697890 AGTGGTGGGGACCCAGGAGCAGG - Intergenic
969867435 4:10084887-10084909 CGTCGCGGGGAGCCACAAGGGGG + Intronic
970178555 4:13363801-13363823 AGTGGTGGGGATTGACAAGCTGG - Intronic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
978577828 4:110203546-110203568 GTTGGTGGGTAGACAGAAGCAGG + Intergenic
980441713 4:132856428-132856450 GGTGGTTGTGAGGCACAAGGGGG + Intergenic
982866816 4:160523744-160523766 GTTGGCGGGGAGGCACAAGGAGG - Intergenic
983715870 4:170780630-170780652 GGTGGTTGGGAGCCAGAACATGG + Intergenic
986750889 5:10787046-10787068 GGAAGTGGGAAGCCAGAAGCAGG - Intergenic
987905181 5:24067573-24067595 GGTGGTCTGCAGCCAAAAGCCGG - Intronic
992550141 5:77851994-77852016 GGTGGCGGGGAGCCGGGAGCCGG - Intronic
996666575 5:126066755-126066777 AGTGGGGTGGAGCAACAAGCAGG + Intergenic
998148072 5:139741558-139741580 GGCGGTGGGGAGCAGCAAGGGGG + Intergenic
999506808 5:152206990-152207012 TGTGATGGGGAGCCACAGGCAGG + Intergenic
1002634539 5:180600585-180600607 GGAGGTGGGGAGGCATAGGCGGG + Intergenic
1003263988 6:4550284-4550306 GGTGGTGGAGTCCCACATGCTGG - Intergenic
1003379610 6:5611390-5611412 GGCAGTGGGGAGCCACAGGATGG + Intronic
1003416255 6:5911026-5911048 GATGGTGGGGAGAAACAAGGGGG + Intergenic
1003882089 6:10488106-10488128 GGAGGTGTGGAGAGACAAGCCGG - Intergenic
1003896198 6:10609913-10609935 GGTGGTGGGGCATCTCAAGCTGG + Intronic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006394811 6:33780375-33780397 GGTGATGCGGAAGCACAAGCAGG + Intronic
1006510499 6:34518716-34518738 GGTGGTGGAGAGCCACTGGAAGG - Intronic
1007841574 6:44720433-44720455 GGTGGTGGGCAGCCAGAAACAGG + Intergenic
1008134060 6:47752790-47752812 GGTGGTGTGAAGCCACAGGGAGG - Intergenic
1008807491 6:55449380-55449402 GGGAGTGGTGAGCCACAAGGTGG + Intronic
1009978512 6:70699874-70699896 AGTGGTGTGGAGCACCAAGCAGG - Intronic
1010752470 6:79631116-79631138 GCTGGAGGGGAGCCACAGCCCGG - Intergenic
1010837793 6:80611870-80611892 GGTTGTGGGAAGCCTGAAGCTGG - Intergenic
1011629908 6:89313125-89313147 AGTGTTGGGAAGCCACTAGCAGG + Intronic
1012979048 6:105810811-105810833 GGTGGTGGGGAGCAGAAAGAGGG + Intergenic
1013073507 6:106750648-106750670 GGTGGTGCTGAGCCACACGGAGG - Intergenic
1014930703 6:127332572-127332594 GGTGGTGGGGAGGCAGGAGGTGG + Intronic
1015923713 6:138289924-138289946 GGAGATGGGAAGCCACAACCCGG + Exonic
1016312975 6:142754477-142754499 AGTGGTGAGGATCCACAAACTGG + Intronic
1016663755 6:146611082-146611104 GGTTGTGGGCAGGCACATGCTGG + Intronic
1017252859 6:152300672-152300694 GGTGAAGGGGAGCGACAGGCAGG + Exonic
1017722233 6:157251742-157251764 GGAGCTGGGGAGCGACAAGAGGG - Intergenic
1018391443 6:163344696-163344718 GGAGGTGGGGAGCAATCAGCCGG - Intergenic
1019932753 7:4234597-4234619 GGGGCTGGGGGGCCACAACCAGG - Intronic
1021454758 7:20817927-20817949 GGTGGCGGGGACTGACAAGCAGG - Intergenic
1021616434 7:22507147-22507169 GGTGGCAGGGAGTCACCAGCAGG - Intronic
1022926234 7:35058358-35058380 GGTGGCAGGGAGTCACCAGCAGG - Intergenic
1023570434 7:41565988-41566010 GGGGGTGGGGAGACACAATCTGG - Intergenic
1023809042 7:43897310-43897332 GGTGGTGGGGAGCGCAGAGCAGG + Intronic
1024619710 7:51146973-51146995 GGTGATGGGGAGCCAGCAGGGGG + Intronic
1027217229 7:76191876-76191898 TTGGGTGGGGAGCCACAAGATGG - Intergenic
1028376021 7:90147190-90147212 GGTGGCAGGGAGTCACCAGCAGG + Intergenic
1028656141 7:93209578-93209600 GGTGGGGGGTAGCCAAAAGTTGG - Intronic
1029096111 7:98086222-98086244 GGTGGTGGAGAGTCCCAGGCGGG + Intergenic
1029592962 7:101519492-101519514 AGTGGCAGGGAGCCACCAGCAGG - Intronic
1029611600 7:101629563-101629585 GATGATGGGGAGCCAGAAGGGGG + Intergenic
1029649318 7:101879933-101879955 GGTGGTGGGTGGCGACAAACTGG + Intronic
1029824244 7:103173046-103173068 GGTGGCAGGGAGTCACCAGCAGG - Intergenic
1032531535 7:132624764-132624786 GGTGGTGGGGAGCCTAAATAGGG - Intronic
1032638769 7:133741267-133741289 CCTGGTGGGGAGAGACAAGCTGG - Intronic
1034190001 7:149206643-149206665 GGTGGTGGGGAGGAACAGGCAGG + Intronic
1037752436 8:21691667-21691689 CGTGGTGGGGAGCCACAGCTTGG - Exonic
1037813738 8:22101367-22101389 GGAGATGGGGTCCCACAAGCAGG + Intronic
1037925297 8:22839415-22839437 GCTGGTGGGGAGGCAGAGGCTGG + Intronic
1038547958 8:28440549-28440571 GGTGGGGGGGAACCACACACAGG - Intronic
1038792357 8:30679648-30679670 GGTGGTTGGGATCCATATGCAGG - Exonic
1038798146 8:30727541-30727563 CGTGGTGGAGAGCCACAAGCTGG - Exonic
1039834622 8:41246632-41246654 GGAGGTGGGGAGCCATAAAGGGG - Intergenic
1041142971 8:54842771-54842793 GGTGGTGGCGGGACACAAGTAGG - Intergenic
1041416080 8:57609927-57609949 GCTGTTCGGGAGCCACAGGCTGG - Intergenic
1041775623 8:61519750-61519772 GATGGAAGGGGGCCACAAGCCGG + Intronic
1047684804 8:127294159-127294181 GCTATTGGGGATCCACAAGCAGG - Intergenic
1049347274 8:142145713-142145735 AGTGATGGGGAGCCACCAGCAGG + Intergenic
1049381683 8:142319462-142319484 GGGGGTGGCGAACCCCAAGCGGG - Intronic
1049523270 8:143106070-143106092 GGGGGTGGGGAGCAACAGGAGGG + Intergenic
1050669943 9:7984586-7984608 GGTGGTGGGGAGGCAGTAGGGGG + Intergenic
1052342894 9:27380665-27380687 GGTGGGGAGGGGCCAGAAGCTGG - Intronic
1052678105 9:31652616-31652638 GCTGGTGGAAAGCCACAAGGTGG - Intergenic
1052915686 9:33923072-33923094 GGAGGTGGGGAGCCTGGAGCTGG - Intronic
1054440865 9:65258913-65258935 GGGGGTGGGGGGCAAAAAGCCGG + Intergenic
1054489411 9:65762573-65762595 GGGGGTGGGGGGCAAAAAGCCGG - Intergenic
1056280929 9:85040739-85040761 GGGGGTGGGGACCCACATGGGGG - Intergenic
1060051276 9:120380066-120380088 GGTGTTTGGGAACCACAGGCTGG + Intergenic
1060918161 9:127403422-127403444 GGTGGGGGGGAGCCACAAAGAGG - Intronic
1060984691 9:127813337-127813359 GTGGGTGGGGCGCCAGAAGCAGG - Exonic
1061168857 9:128940520-128940542 GGGGGTGGGGAGTCCCAAGTGGG - Intronic
1061517308 9:131097138-131097160 GCTTGCGGGGAGCCACGAGCCGG - Intronic
1061931693 9:133836180-133836202 GGGGCTGAGGAGCCACAACCTGG + Intronic
1062540302 9:137039086-137039108 GGTGGTGGGCACCCACATCCAGG + Intergenic
1202779796 9_KI270717v1_random:24200-24222 GGTGGCGGGGGGCAAAAAGCCGG + Intergenic
1203520953 Un_GL000213v1:44158-44180 CGTGGTGCTGAGCCGCAAGCTGG - Intergenic
1186372380 X:8960384-8960406 GGTGTTGGGGAGTCAGATGCAGG - Intergenic
1189390327 X:40570897-40570919 GAAGGTGGGCAGCCACATGCTGG + Intergenic
1192217506 X:69172950-69172972 GAAGGTGTGGAGCCACAGGCAGG + Intergenic
1193021289 X:76796721-76796743 GGTGGTGGGGGGCAGCTAGCTGG - Intergenic
1197608309 X:128609725-128609747 GGTGCTGGGGAGGCTGAAGCAGG + Intergenic
1197963554 X:132032038-132032060 GGTGGTGGGGAGAGGCAGGCAGG - Intergenic
1198379871 X:136073919-136073941 GGTGGAGGGGAGCCCCAACTGGG + Intergenic
1199277636 X:145964743-145964765 AGTGGTGTAGAGCAACAAGCAGG + Intergenic
1200064293 X:153497264-153497286 GTGGGTGGGGACCCACCAGCTGG + Intronic
1200126201 X:153816157-153816179 GTGGGTGGGGACCCACCAGCTGG - Intronic
1200181209 X:154151727-154151749 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1200186854 X:154188841-154188863 AGTGGTGGGGAGGCAAGAGCAGG - Intergenic
1200192505 X:154225979-154226001 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1200198260 X:154263783-154263805 AGTGGTGGGGAGGCAAGAGCAGG - Intronic
1202093650 Y:21221122-21221144 GGTGCTGGGGAAGAACAAGCAGG - Intergenic