ID: 1184474080

View in Genome Browser
Species Human (GRCh38)
Location 22:44711328-44711350
Sequence CAGAGGGAACAGCAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 10, 3: 66, 4: 605}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184474067_1184474080 21 Left 1184474067 22:44711284-44711306 CCCACACAGCTGCGAGGGAGGGC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG 0: 1
1: 0
2: 10
3: 66
4: 605
1184474068_1184474080 20 Left 1184474068 22:44711285-44711307 CCACACAGCTGCGAGGGAGGGCA 0: 1
1: 0
2: 2
3: 17
4: 204
Right 1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG 0: 1
1: 0
2: 10
3: 66
4: 605

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184474080 Original CRISPR CAGAGGGAACAGCAGGATGG AGG Intronic
900001497 1:17225-17247 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900021216 1:187747-187769 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
900165022 1:1241110-1241132 CAGCGGGGACAGCAGTGTGGGGG - Intergenic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901181987 1:7348157-7348179 CAGAGGGAACACAAAGCTGGGGG - Intronic
901810190 1:11763005-11763027 CAGAGGGGACAGCAGCACAGAGG + Intronic
901817039 1:11800286-11800308 CAGTGGGAAGAGGAGGAGGGAGG - Exonic
902277628 1:15350793-15350815 GAGTGGGCACAGCAGGGTGGGGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902704207 1:18193199-18193221 CAGAGGGAAGAGCAGCATAGAGG + Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
903775600 1:25791538-25791560 CAGAGGGGGCAGCAGCCTGGAGG - Intergenic
904316692 1:29670497-29670519 AAGAGGGAGCTGCAGGGTGGAGG + Intergenic
904833123 1:33318386-33318408 GAGAGTGAATGGCAGGATGGGGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905008621 1:34731250-34731272 CAGAGGGAACAGTGGGAGAGAGG - Intronic
905345434 1:37308116-37308138 CAGCGGGCACAACACGATGGGGG - Intergenic
905872901 1:41415254-41415276 CACAGGGAGAAGCAGGAAGGTGG - Intergenic
905890707 1:41516750-41516772 CAGAGGGAGCAGCAGGTGTGGGG - Intronic
905991050 1:42337037-42337059 CAGAAGGAACAGCTAGCTGGTGG + Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906135254 1:43495268-43495290 CACTGGGAACAGCAGGAGGGAGG + Intergenic
906188818 1:43882245-43882267 CAGAGGGAACAGTGGTATAGAGG + Intronic
906205157 1:43982584-43982606 CAGAGGGACCTGGAGGATGCAGG + Intronic
906260860 1:44388666-44388688 CAGATGGAACAAAAAGATGGAGG - Intergenic
906955397 1:50369866-50369888 CAGAGCGAAGAGCAGGTGGGAGG + Intergenic
907044993 1:51295114-51295136 CTCAGGGAACAGCTGGATGTGGG + Intronic
907697817 1:56751682-56751704 GAGAAGGAACAGAAGAATGGTGG - Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
908333691 1:63097936-63097958 AAGAAGGAAAAGAAGGATGGGGG + Intergenic
909751080 1:79161875-79161897 CAGAGGGAATAGCAGGTAGAAGG + Intergenic
910231204 1:84988903-84988925 CTGGGGGAACAGCAGTAGGGTGG - Intronic
911037873 1:93569434-93569456 CAGAAGGAAGGGCAGCATGGTGG - Intronic
911096162 1:94056733-94056755 CAGAAAGCACAGCATGATGGTGG + Exonic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912921966 1:113877148-113877170 CATAGGGAACAGTAGGAGGAGGG + Intergenic
913261840 1:117005567-117005589 CAGAGGGAAGAGTTAGATGGAGG - Intronic
913476623 1:119244535-119244557 CAGAGGGAAAAGAAGGAAAGAGG - Intergenic
915009845 1:152675369-152675391 CAGAGGGATGGGGAGGATGGAGG + Intronic
915011002 1:152686197-152686219 CAGAGGGATGGGGAGGATGGAGG + Intronic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915480048 1:156178270-156178292 CAGAGGGTAGAGGAGGAAGGTGG - Intergenic
915704803 1:157833504-157833526 CAAAGGGATCTGCAGGATGGGGG + Exonic
916423578 1:164659787-164659809 CAGAGGTAGCAGCAGAATCGAGG + Intronic
918241719 1:182626164-182626186 TAGAGGAATCAGCAGGAAGGTGG - Intergenic
918307594 1:183261173-183261195 CAGATGCACTAGCAGGATGGAGG + Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920100746 1:203515657-203515679 CAGAGGGAACAGCTGAATCCAGG + Intergenic
922659163 1:227414117-227414139 CAGTGGGAAGAGCCGGTTGGTGG + Intergenic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
922898983 1:229121901-229121923 CAGAGGAAACAGCAACATAGAGG + Intergenic
1062867805 10:871602-871624 CAGAGGGGACTGCAGCCTGGAGG - Intronic
1063364824 10:5483641-5483663 CAGAGGGGACCGTTGGATGGAGG - Intergenic
1063936963 10:11088260-11088282 CAGAGTGAACAGCATGAGTGAGG + Intronic
1064333999 10:14422136-14422158 CAGAGGGAGGAGCAGGCTTGCGG - Intronic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1064943565 10:20761998-20762020 CAGAGGGAACAGCATCAGAGAGG - Intergenic
1065111607 10:22445334-22445356 CAAAGGGAAACGCAGGGTGGTGG - Intronic
1067089000 10:43257182-43257204 CAGAGGTCACAGCAAGAGGGAGG + Intronic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1067702375 10:48583211-48583233 CAGCTGGGACACCAGGATGGGGG - Intronic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068784859 10:60960884-60960906 CAGAGCTGACAGCAGGATTGTGG + Intronic
1069800990 10:71081362-71081384 CAGTTAGAGCAGCAGGATGGAGG - Intergenic
1069991357 10:72318544-72318566 CAGAAGGAACAGCATGAGTGAGG + Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070545714 10:77450865-77450887 CAGGGGTAACAGAATGATGGGGG + Intronic
1070560555 10:77563585-77563607 GACTGGGAATAGCAGGATGGAGG - Intronic
1072634079 10:97165994-97166016 CAGAGGGGACAGCTGGAGTGAGG - Intronic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1073818847 10:107237056-107237078 CTGAGGGACCAGCAGGAAAGGGG + Intergenic
1074533580 10:114313112-114313134 GAGAGGGGGCAGCAGGAAGGAGG + Intronic
1074895159 10:117770957-117770979 CAGAGGGAGCAGCTGGGAGGTGG + Intergenic
1075063044 10:119270016-119270038 CAGAGGGAACAGCAATAGGAAGG - Intronic
1075064827 10:119282379-119282401 CAGGGGGAACAGCAGCACTGGGG - Intronic
1075741348 10:124698243-124698265 GAGAGGCCACACCAGGATGGGGG + Intronic
1075743465 10:124710128-124710150 CAGAGGGCACAGCAGCAGGATGG + Intronic
1075913592 10:126147357-126147379 CAGAGGGAACAGGAGGGGAGAGG - Intronic
1076623913 10:131810164-131810186 CAGGAGGAAAAGCAGGATGATGG + Intergenic
1076638501 10:131899058-131899080 CAGAAGGCACAGCTGGGTGGGGG - Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1077136319 11:1001097-1001119 CAGGGGGAACCACAGGGTGGAGG - Intronic
1077147689 11:1053300-1053322 CTGTGGGAACTGCAGGAAGGAGG - Intergenic
1077298804 11:1838001-1838023 CAGAGGAGACAGCAGCGTGGAGG - Intergenic
1077501916 11:2913154-2913176 CTGAGGGAGCAGCAGGATATGGG + Intronic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078241436 11:9534300-9534322 AAGTGGGAAAAGCAGGCTGGAGG - Intergenic
1078774663 11:14383138-14383160 CTGAGGGGTCAACAGGATGGTGG - Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080484182 11:32687415-32687437 AAGAGGGGGCAGCAGAATGGTGG + Intronic
1080643984 11:34174822-34174844 CAGAGAGAACAGCATGAGTGAGG - Intronic
1080752387 11:35162730-35162752 CAGAGGGAGAAGCTGGATTGTGG - Intronic
1080808260 11:35676381-35676403 CAGAAGGAACAGAAGGAGAGGGG - Intronic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1083229376 11:61306139-61306161 CACAGGGATCAGGAGGGTGGAGG - Intronic
1083764008 11:64833568-64833590 CAGAGGGGCAAGCAGGGTGGGGG - Intronic
1083840138 11:65299558-65299580 CAGAAGGCAGAGCTGGATGGAGG - Intronic
1084476063 11:69390498-69390520 CAGAGGGCAAAGCAGCCTGGAGG + Intergenic
1084641543 11:70429450-70429472 CAGAGGGCAGGGCAGGTTGGCGG - Intronic
1084915222 11:72423900-72423922 TAGAGGGAACAGCAGGTGGAAGG - Intronic
1086920743 11:92583574-92583596 CAAAGAGAACAGCAGAATAGGGG - Intronic
1088332749 11:108670319-108670341 GAGAGGGAACAGGAGTAGGGAGG + Intronic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088741282 11:112769438-112769460 CAGTGGGGGCAGCAGGGTGGGGG + Intergenic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089406307 11:118200512-118200534 AACAGGGAGCAGCAGGATTGTGG + Exonic
1090228937 11:125088140-125088162 CAATTGGAACAGCAGCATGGAGG + Exonic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091324697 11:134677481-134677503 AGGAGGGAACAGGAGGTTGGCGG - Intergenic
1091374582 12:17340-17362 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1091483906 12:865144-865166 CAGAGGCAACAGCAGAAAGATGG - Intronic
1091602772 12:1928078-1928100 CAGAGGCCACAGCAGCCTGGAGG + Intergenic
1091976035 12:4826379-4826401 CAGAGGCAAAAGCAGAAAGGAGG + Intronic
1092208455 12:6631103-6631125 AAGAAGGAACACCAGGAAGGAGG + Intronic
1092233778 12:6792873-6792895 CACAGGGAGCTGCAGGCTGGGGG + Intronic
1092301942 12:7259554-7259576 CAGAGGGAAGAACAGGTTGGTGG + Intergenic
1092993049 12:13921626-13921648 CAGATGGTACAGCAGTATTGGGG + Intronic
1093135764 12:15448596-15448618 CATAGGGAAAAACAGAATGGAGG + Intronic
1093787380 12:23208176-23208198 CAAAGGGAACAGCAGCATGGTGG - Intergenic
1094441757 12:30485616-30485638 CAGAGGGAGCAGCAGGAAATGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096805912 12:54141032-54141054 CAGAGGCCAGAGCAGGAGGGAGG + Intergenic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097247329 12:57613787-57613809 CAGATGGAAAAGCAGGCAGGAGG - Intronic
1097263306 12:57731764-57731786 CATGGGGGACAGGAGGATGGGGG + Intronic
1097960138 12:65524244-65524266 CAGAGGGAACAGCAGGGGTGAGG + Intergenic
1098197464 12:68017131-68017153 CAGAAGGAACAGCAGCAGGTAGG + Intergenic
1098270014 12:68761044-68761066 CAGAGGCAACAGCAGGTGCGAGG + Intronic
1099363749 12:81742073-81742095 CAGCAAGAACACCAGGATGGTGG + Intronic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1100897541 12:99201024-99201046 CAGTGGGAACAGCAGGTTAATGG + Intronic
1101458952 12:104869319-104869341 CAGAGGGGAAAACAGGAAGGAGG + Intronic
1101737961 12:107477226-107477248 TACAGGCAACAGCAGGAGGGAGG - Intronic
1102145986 12:110655482-110655504 CAGAGGCCCCACCAGGATGGAGG + Intronic
1102415386 12:112757962-112757984 CAGCTGCCACAGCAGGATGGTGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102593552 12:113975294-113975316 CAGAAGGGACAGAAGGATTGGGG - Intergenic
1103405961 12:120675451-120675473 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1103841975 12:123872364-123872386 CAGAGGGACCTGCAGGTTTGTGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1105255423 13:18741274-18741296 CAGAGGGAAAAGCAGAATTAAGG + Intergenic
1106410959 13:29511215-29511237 CAGGGGTGACCGCAGGATGGTGG - Exonic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106636430 13:31533578-31533600 CAGAGGGCACAGCAAGAAGGTGG - Intergenic
1108173291 13:47766415-47766437 CAGAGGGTGCAGCAAGATGGAGG + Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108692380 13:52871026-52871048 CTGAGGGAACAGAAAGAGGGAGG + Intergenic
1108922399 13:55692505-55692527 AAGAAGGCACAGCAAGATGGTGG + Intergenic
1109745028 13:66613557-66613579 CAGAGTGTAAAGCAAGATGGAGG - Intronic
1109766749 13:66910193-66910215 CAGAGGGTCCAGCCAGATGGAGG + Intronic
1110391386 13:74978781-74978803 AAGAGGGAACTGCCAGATGGAGG + Intergenic
1111831735 13:93338855-93338877 CTGAGGGAGCAGGAAGATGGAGG - Intronic
1113391625 13:109903400-109903422 CTGAGGGAATAGCAGGAGAGAGG + Intergenic
1113453829 13:110433167-110433189 CAGAGGGGACAGGAGCCTGGGGG - Intronic
1113509766 13:110843827-110843849 TAATGGGAACAGCAGCATGGGGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114189111 14:20427804-20427826 CAGTGGGGAGAGCAGGATGGGGG + Intergenic
1114482426 14:23044098-23044120 CAGAGGGAGCATCAGGAAGGAGG - Exonic
1116866213 14:50033747-50033769 CAGTGGGAGGAGCCGGATGGTGG + Intergenic
1116911417 14:50469617-50469639 CAGAGGGAACAGAATGAAAGGGG + Intronic
1117070178 14:52049052-52049074 CTCAGGGCACAGCAGGAGGGTGG + Intronic
1117294090 14:54363063-54363085 CTCAGGGACCATCAGGATGGAGG + Intergenic
1117718399 14:58604063-58604085 AAGAGGAAACACCAGGATGGGGG - Intergenic
1118259747 14:64235830-64235852 CACAGGGCAGGGCAGGATGGGGG - Intronic
1119204482 14:72783883-72783905 CAGGGGCAGCGGCAGGATGGGGG + Intronic
1119759780 14:77142007-77142029 GAGAGGGAAGGGCAGGATGATGG - Intronic
1120337667 14:83178923-83178945 GAGAGTGAAGGGCAGGATGGGGG + Intergenic
1120499061 14:85271349-85271371 CAGAAGGAACAGAGAGATGGTGG + Intergenic
1120868865 14:89319315-89319337 CAGAGGGAAAAGGTGCATGGGGG + Intronic
1121007718 14:90500935-90500957 CAGAGGAGACAGCAGGACTGGGG + Intergenic
1121253209 14:92514364-92514386 CAGCGGGTGCAGCAGGCTGGCGG - Intronic
1121402024 14:93688382-93688404 CAAAGGGAATAGCAGCAGGGGGG + Intronic
1121413668 14:93764235-93764257 CAGAGGGACCTGCAGGTTGGAGG - Intronic
1121957014 14:98223463-98223485 CAGAGGGAAGAGTAAGATGGCGG + Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122771689 14:104100554-104100576 AGGAGGGAACAGCAGGAAGAAGG - Intronic
1122854690 14:104554442-104554464 CTTAGGGAACAGCAGGACAGAGG - Intronic
1122954625 14:105064913-105064935 CAGAGGGAAAAGCAGGGCAGTGG - Intronic
1122974405 14:105165194-105165216 CTGAGGGAGGAGCAGGGTGGTGG - Intronic
1123629807 15:22253789-22253811 CTGAAGGAAAAGCAAGATGGCGG + Intergenic
1123768938 15:23509850-23509872 CAGGGGCAACAGCAGAATTGGGG + Intergenic
1123798490 15:23797765-23797787 AAGCGGGAAAGGCAGGATGGAGG + Intergenic
1124465558 15:29936180-29936202 CAGAGGGAAAGGGAGAATGGAGG - Intronic
1124992467 15:34689489-34689511 CACAGGAAACAGCAAGAAGGTGG + Intergenic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126859095 15:52866821-52866843 CAGTGGGAAGAGCCGGATGAAGG - Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1127559786 15:60124596-60124618 CAGTGGGGACAGCAGGTTGGTGG + Intergenic
1127635950 15:60869822-60869844 CAGAGGGAACAAGAGGAGGATGG - Intronic
1127761119 15:62140013-62140035 CAGAGGGGTCAGCTGGATAGAGG - Intergenic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128698985 15:69790154-69790176 CTGAGGGAAAAGGAGGATGTGGG - Intergenic
1129363949 15:75043065-75043087 CAGAGGCCACAGCAGGCAGGAGG - Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1129867998 15:78923698-78923720 CAGAAGGTGCAGCAGGAAGGTGG - Intronic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1131070555 15:89463088-89463110 CAGAGGCAACTGCAGGTTTGTGG + Intergenic
1131338384 15:91572234-91572256 CAGAGGGAATAAGAGGCTGGAGG + Intergenic
1131382218 15:91973468-91973490 CAGATGCAACAGCAGGAAGAAGG + Intronic
1131931917 15:97452142-97452164 TACAGAGAACAGCAGGATAGGGG + Intergenic
1132452013 15:101973713-101973735 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
1132454882 16:16908-16930 CAGCTGGAACAGCAGGTGGGAGG - Exonic
1133018078 16:2954100-2954122 CAGAGGGGCTGGCAGGATGGGGG - Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133357418 16:5146910-5146932 CAGAGGGAACAGCATGTGTGAGG - Intergenic
1133682827 16:8136637-8136659 GAGAGGGAACAGCAGAATAGAGG - Intergenic
1133692698 16:8231882-8231904 CAGATGGAAGAGCAACATGGTGG - Intergenic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1133929135 16:10217996-10218018 CAGTGGGAGCAGGAGGCTGGTGG + Intergenic
1134297648 16:12961184-12961206 CAGAGGGAACTGCATGGTGCAGG + Intronic
1134844553 16:17428937-17428959 CATAGGGATCAGGAGGATGCAGG + Intronic
1135168615 16:20163647-20163669 CTGAGGGACCAGCAGGATCCTGG + Intergenic
1135182964 16:20291404-20291426 CAGAGGGGACAGCTGTATTGAGG + Intergenic
1135506066 16:23037392-23037414 CATAGGTAATATCAGGATGGAGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1138370090 16:56519848-56519870 CACAGGCAGCAGCATGATGGCGG + Exonic
1139946366 16:70645075-70645097 AAGAGGGAAGAGTAGGAAGGAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1141384027 16:83602969-83602991 CAGACGGAACAGTAGCAAGGAGG + Intronic
1141645828 16:85367049-85367071 CAGAGGCCACGGCAGGGTGGTGG - Intergenic
1141694076 16:85611789-85611811 CATCGGGAACAGATGGATGGGGG + Intronic
1141753979 16:85979080-85979102 CAGAGCGAGCAGCAGACTGGAGG + Intergenic
1141904085 16:87011510-87011532 CAGTGAGATCAGCAGGTTGGAGG - Intergenic
1141973333 16:87496967-87496989 CTGAAGGAAAAGCAAGATGGTGG - Intergenic
1142153159 16:88521545-88521567 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142153200 16:88521686-88521708 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142359559 16:89619738-89619760 CAGGGGGCACAGCAGGCTGCAGG - Intronic
1142513584 17:413048-413070 AAGATGGAAGAGGAGGATGGGGG - Intronic
1142578000 17:921955-921977 CAGAGGGAGAAGCAGGTTGGAGG - Intronic
1143208837 17:5167902-5167924 TAGAGGGAACAGGAGGAAAGGGG - Intronic
1143316814 17:6039175-6039197 CAAAGGGAACAGCATATTGGGGG - Intronic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143383679 17:6511982-6512004 CAGAAGGAACAGCAGGCTTATGG + Intronic
1143525838 17:7472000-7472022 CAGAGGGAACCGCAAGATGTAGG - Intronic
1143764621 17:9129333-9129355 CAGAGGGAACAGCTGAGGGGAGG + Intronic
1143981499 17:10874034-10874056 CAGACTGGACAACAGGATGGTGG + Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1145137683 17:20424562-20424584 TAGAGGGAACAGGAGGAAAGGGG - Intergenic
1146055553 17:29579009-29579031 CAGAGGGAAGAACAGGACAGAGG + Intronic
1146182588 17:30707639-30707661 TAGAGGGAACAGGGGGAGGGGGG - Intergenic
1146554505 17:33812178-33812200 CAGAGGGATCAGCAGGGTGACGG + Intronic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1147982821 17:44285255-44285277 CTGCGGGATCAGCGGGATGGGGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1148868029 17:50639322-50639344 GTGGGGGAACAGCAGGATTGAGG - Intronic
1149173244 17:53838851-53838873 CAAACGGAAAAGCAGGATGATGG - Intergenic
1149386862 17:56151002-56151024 CAGAGTGAGAGGCAGGATGGAGG + Intronic
1149871453 17:60185659-60185681 TAGAGGGAACAGGAGGAAAGGGG + Intronic
1151188197 17:72379136-72379158 CAATGGGAACAGCAGGATGGGGG + Intergenic
1151311247 17:73293617-73293639 CAGATGGAACAGCACGCTGGAGG + Intronic
1151324163 17:73368594-73368616 CTGTGGGAACAGAAGGATGTGGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151850290 17:76685873-76685895 CAGAGGGAAAAGCCCCATGGGGG + Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152594414 17:81231482-81231504 CAGAGGGGACACCTGGGTGGCGG + Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153748168 18:8201662-8201684 GAGAGGGCACAGCAAGAAGGTGG - Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153917407 18:9758276-9758298 GAGTGGGATCAGCAGGATGGGGG + Intronic
1154321762 18:13359853-13359875 CTGAGGGCAAAGCAGGTTGGAGG - Intronic
1154435594 18:14339330-14339352 CAGAGGGAAGAGCAGAATTAAGG - Intergenic
1155010097 18:21768711-21768733 CAGTGGGAAGATCAAGATGGAGG + Exonic
1155400628 18:25435187-25435209 GAGAGGGACCACCAGGAAGGGGG + Intergenic
1155484929 18:26331124-26331146 CACTGGGAAGAGCAGGAAGGTGG + Intronic
1155501466 18:26491228-26491250 AGGAGGGCACAGCAGGAGGGTGG + Intronic
1156109031 18:33700954-33700976 CAGAGAGAAGAGCACGATAGGGG + Intronic
1157652076 18:49343365-49343387 CAGAGGGAACAGCAGCTTCAAGG - Intronic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1159959071 18:74541522-74541544 CACTGGGATCAGTAGGATGGTGG - Intronic
1160373512 18:78393410-78393432 CAGAGGGAATTGCAGGGTGTCGG - Intergenic
1160448693 18:78947186-78947208 AAGAGGGAAGAAGAGGATGGAGG + Intergenic
1160579036 18:79873358-79873380 CAGAGGGAACGGGAGTGTGGGGG - Intronic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1160835288 19:1122070-1122092 CGGAGGGAAAAGGAGGATGGAGG - Intronic
1160847299 19:1172268-1172290 GATGGAGAACAGCAGGATGGGGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1162070911 19:8151593-8151615 GGGAGGGAACCCCAGGATGGAGG + Intronic
1162462150 19:10819650-10819672 GTGAGGGAAAAGGAGGATGGAGG + Intronic
1162582665 19:11540168-11540190 GAGAGGGAAAAGCAGGGAGGTGG + Intronic
1162600602 19:11665464-11665486 CAGTGGGCACAAGAGGATGGGGG + Intergenic
1162879108 19:13644759-13644781 CAGAGTGAATCTCAGGATGGAGG - Intergenic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1163786759 19:19278822-19278844 AAGAGGGAGAAGCAGGAAGGAGG + Intronic
1164441378 19:28282870-28282892 CAGTGGGAAGAAGAGGATGGTGG - Intergenic
1164559916 19:29283638-29283660 CAGAGGGAATATCAGCAGGGAGG + Intergenic
1165095219 19:33406532-33406554 CGGAGGAAACAGCAAGGTGGTGG + Intronic
1165120398 19:33555256-33555278 TAGAGGGAACAGCCTGATAGTGG + Intergenic
1165334092 19:35156923-35156945 CAGAGGCAGGACCAGGATGGGGG + Intronic
1166006055 19:39907618-39907640 CAAAAGGAAGAGCTGGATGGAGG + Intronic
1166072385 19:40394800-40394822 CAGAGGGCACAGCAGGCTACAGG - Exonic
1166739349 19:45104678-45104700 CAGAGGGAAAGGCAGCAGGGAGG - Intronic
1166810899 19:45514192-45514214 CTGCGGGAAGAGCAGCATGGGGG + Intronic
1167259880 19:48452433-48452455 CAGAGGGAAGAGCAGGGGCGGGG + Intronic
1167577399 19:50324389-50324411 CACAGGGAACAGGAGGGTGGGGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1168657259 19:58139524-58139546 CACAGGGTACAGCAGGAAGCAGG + Intronic
924968470 2:100739-100761 TAGAGGGAACAGAAAGATGGAGG + Intergenic
925068786 2:950665-950687 CTGGGGGAAGTGCAGGATGGGGG - Intergenic
925121294 2:1420729-1420751 CAGGAGGGACAGAAGGATGGTGG + Intronic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
926037308 2:9645799-9645821 TAGAGGGAAGAGCATGATGCAGG - Intergenic
926121755 2:10245058-10245080 AAGAGGGAAGAGGTGGATGGGGG + Intergenic
926442456 2:12904092-12904114 TAGAGGGAACAGCAAGAAGGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927553489 2:24017612-24017634 CAGAGGGGACCCCAGGTTGGGGG - Intronic
927641718 2:24849741-24849763 CAGAGGGGAAAGGAGGAGGGGGG + Intronic
927723901 2:25406024-25406046 GAGAGGGAAGAGCAGGAGGCTGG + Intronic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
928087113 2:28352831-28352853 CAGTCGTCACAGCAGGATGGTGG + Intergenic
928276677 2:29907314-29907336 CAGAGGGTTCAGCAGCATGGAGG - Intronic
928278348 2:29921817-29921839 GAGAGGGAACAGAGGGAGGGTGG - Intergenic
929095586 2:38260638-38260660 CAGGGGGAAACCCAGGATGGTGG - Intergenic
929595896 2:43175633-43175655 CAGGGGCAAGAGAAGGATGGAGG + Intergenic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
930122054 2:47768422-47768444 CAGAGGGGCCAGGAGGGTGGTGG - Intronic
930273836 2:49288389-49288411 CTGAGGGAAGAGCAGGAGAGAGG - Intergenic
930433101 2:51305607-51305629 CAGAGGGAACAGCTGAAGCGGGG - Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
932798182 2:74715708-74715730 CACAGGGGACAGCAGTACGGGGG - Intergenic
933278124 2:80304172-80304194 CAAAGGGAGCAGCTGAATGGAGG - Exonic
933279710 2:80319663-80319685 CAGAGTGAAAAGCAGAATTGTGG - Intronic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
933897129 2:86821831-86821853 CAGGGGGAAGAGAAGGGTGGAGG - Intronic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935865825 2:107386679-107386701 CTGAAGGAACAGCTGGATGCTGG - Intergenic
935875329 2:107500051-107500073 CACATGGAACATCAGGAAGGTGG - Intergenic
936049534 2:109212760-109212782 CAGAGGGAACTGACGGGTGGGGG - Intronic
936409083 2:112238091-112238113 TAGAGGGAGCTGGAGGATGGAGG - Intronic
936568228 2:113596189-113596211 CAGCTGGAACAGCAGGTGGGAGG + Intergenic
936684776 2:114815041-114815063 GAGAGGGAGCAGAAGGGTGGAGG - Intronic
937552318 2:123108922-123108944 GAGAGGGAGGAGCAGGATGGTGG - Intergenic
937937041 2:127254456-127254478 CAGACAGAACAAAAGGATGGAGG - Intergenic
938397363 2:130961445-130961467 AAGAAGGAACAGCAGCAAGGTGG + Intronic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939241115 2:139560766-139560788 AACAGGGAACAGCAGGAATGCGG + Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
940268854 2:151869701-151869723 CAGAGGGATGAGCAGGAGAGTGG - Intronic
941538131 2:166746124-166746146 CAGAGGTGACATCAGGAAGGTGG - Intergenic
942186999 2:173433619-173433641 CAGGGGGAAGAGCAGGGTTGTGG - Intergenic
944428880 2:199612026-199612048 AAGAGGAAATAACAGGATGGGGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
945108988 2:206344769-206344791 GAGAGGGAACAAGGGGATGGGGG - Intergenic
946029035 2:216690754-216690776 CGGAGGGAAGAGTAGGAGGGAGG + Intronic
946377835 2:219324395-219324417 CACATAGGACAGCAGGATGGGGG + Intergenic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
947029912 2:225782506-225782528 CAGAGGGAAAAAAAGGAAGGAGG - Intergenic
947375371 2:229489895-229489917 CAGAGAGAAAAGCAGCATGAGGG + Intronic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
947654661 2:231816527-231816549 GAGATGGAACAGCTGGTTGGTGG + Intergenic
947720749 2:232367995-232368017 CAGAGGGCACCGCAGGAGGAAGG - Intergenic
948291128 2:236825761-236825783 CAGAGGGGAGAGCAGGCTTGTGG + Intergenic
948511191 2:238466390-238466412 ACCAGGTAACAGCAGGATGGAGG + Intergenic
948753332 2:240144814-240144836 GACAGGGAACAGAGGGATGGGGG - Intergenic
1170008699 20:11697242-11697264 GAGAAGGAAAAGCAGGACGGGGG + Intergenic
1170536545 20:17346404-17346426 GAGGAGGAACAGAAGGATGGTGG - Intronic
1170797984 20:19566392-19566414 CACAGGAAACAGCAGGGTGTGGG - Intronic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171344080 20:24452591-24452613 CAGAGGGAACTGTGGCATGGCGG - Intergenic
1172189962 20:33056021-33056043 CTGTGGGAAGGGCAGGATGGAGG - Intronic
1172230611 20:33333353-33333375 CCCTGGGAGCAGCAGGATGGAGG + Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173582118 20:44154767-44154789 CAGGAGGAAAAGCAGGATTGTGG - Intronic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174662045 20:52221869-52221891 CAGAGGGTACAACAGTTTGGAGG - Intergenic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1175074728 20:56362942-56362964 CAGAGGGGACAGCAGCCAGGTGG - Intronic
1175082566 20:56433329-56433351 TAGAGAGAACAGCATGATGGAGG + Intronic
1175194804 20:57235656-57235678 CAGAGGCAACAGCATGATCGAGG + Intronic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175247642 20:57591364-57591386 GAGAGGGAACAGCATTATAGAGG + Intergenic
1175309183 20:57999537-57999559 CACAGAGAACAGGCGGATGGAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176841438 21:13846303-13846325 CAGAGGGAAGAGCAGAATTAAGG + Intergenic
1178186465 21:30227689-30227711 CTGTGGGAAAATCAGGATGGGGG - Intergenic
1178209881 21:30517503-30517525 CAGAGTGAACAGCATGATTGTGG - Intergenic
1178806589 21:35844791-35844813 CAGAGGGAACAACAGAACTGTGG - Intronic
1179249983 21:39664445-39664467 CAGAGGGGACAGCAGGTGGTAGG - Exonic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179424784 21:41267122-41267144 GCGAAGGCACAGCAGGATGGCGG + Intronic
1179472422 21:41620553-41620575 CAGACGGGACAGCAGGCTGAGGG - Intergenic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180157677 21:45986035-45986057 AAGTGGGAGCAGCAGGAAGGAGG - Intronic
1180202049 21:46229760-46229782 CAGAGGGAAGAGGAAGATGGAGG + Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181394965 22:22614774-22614796 GTAAGGGAAGAGCAGGATGGAGG - Intergenic
1181515786 22:23411473-23411495 CTGAGGGAACAGCTGGTTGGTGG - Intergenic
1181772792 22:25138953-25138975 CAGAGGGAAGACCAGGAAGGGGG - Intronic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182979598 22:34656382-34656404 GAGTGGGAACATCAGGATGTTGG + Intergenic
1183317654 22:37145781-37145803 GAGATGGAAGAGCAGGAGGGAGG - Intronic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1183352338 22:37341280-37341302 CAGAGGGGACAGCAGTAAAGTGG - Intergenic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183529951 22:38347917-38347939 CGGAGGGAAGAGCAAGCTGGAGG + Intronic
1184097305 22:42323455-42323477 CTGAGGGAACAGGAGGACGGTGG + Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184616539 22:45641664-45641686 CAGAGGGAACACACGGATGTAGG + Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1185029811 22:48436289-48436311 CAGAGGGGACAGCAGGGATGGGG + Intergenic
949121258 3:387323-387345 CAGAGGGAAGGGAAGGCTGGTGG + Intronic
949324087 3:2844026-2844048 TATATGGAACAGAAGGATGGGGG - Intronic
949347168 3:3087328-3087350 CACAGGGGACAGCAGGGAGGGGG - Intronic
950159611 3:10750269-10750291 GTGAGGGAACATGAGGATGGTGG - Intergenic
951413981 3:22400593-22400615 CATAGGGAACAGCATGTTGCTGG - Intergenic
951704180 3:25527173-25527195 CAGAAGGATCAGCACGATGTAGG - Intronic
952196056 3:31076258-31076280 GAGCGTGAAAAGCAGGATGGTGG + Intergenic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953263328 3:41361147-41361169 AAGAGGGAACAGCAGCCTTGTGG + Intronic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
954097091 3:48337279-48337301 CAGAAGGCAAAGCAGGAAGGAGG - Intergenic
954410533 3:50368765-50368787 CAGAGGGAACAGCCAGTCGGAGG - Intronic
954415906 3:50393249-50393271 CACAGGGAGGAGCAGGGTGGGGG - Intronic
954430739 3:50469754-50469776 CAGGGGCAATAGCTGGATGGTGG - Intronic
954539046 3:51381731-51381753 CAGAGGCCACAGCAGCATGAAGG + Exonic
956409016 3:68959517-68959539 CAGGGGGAAGGGCAGGAGGGGGG - Intergenic
957061988 3:75489739-75489761 CAGAGGGAACAGCATGTGTGAGG - Intergenic
957150282 3:76477771-76477793 CATAAGGAACAGCAGGAAGAGGG - Intronic
957221431 3:77387884-77387906 GAAGGGGAAAAGCAGGATGGAGG - Intronic
957416934 3:79917461-79917483 AAGAGGGAAGAGAAGGAGGGAGG + Intergenic
958609491 3:96406344-96406366 AAGCGGGAAAAGCAGGAGGGAGG + Intergenic
960987508 3:123290430-123290452 CACAGGGAGAAGCAGGATGATGG - Intronic
961291415 3:125849662-125849684 CAGAGGGAACAGCATGTGTGAGG + Intergenic
961366221 3:126401672-126401694 GAGAGGGAGCAGCAGGTGGGAGG + Intronic
961649997 3:128412550-128412572 CAGAGGGAACAGCAGAGTGAAGG + Intergenic
963323608 3:143836610-143836632 GAGAGGGGACAGAAGGAAGGAGG + Intronic
963973932 3:151460086-151460108 AGGAAGGAACAGCAGGATGAAGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
968588527 4:1446172-1446194 CTGAGGGACCAGCAGGGTGGAGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
969005882 4:4019830-4019852 CAGAGGGAACAGCATGTGTGAGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969426931 4:7129954-7129976 CAGAAGGCAGAGCAGGCTGGGGG + Intergenic
969446232 4:7246273-7246295 CAAAGGGCACAGGTGGATGGGGG - Intronic
969465265 4:7352718-7352740 CAGCTGGAACGGCAGGAAGGTGG + Intronic
969537855 4:7767699-7767721 CAGAGAGCACAGCAGGGGGGCGG + Intronic
969545560 4:7824748-7824770 CTGAGGGAACGGGAGGAAGGGGG + Intronic
969807067 4:9617460-9617482 CAGAGGGAACAGCATGTGTGAGG + Intergenic
972127747 4:35790208-35790230 GAGAGGGAAGGGGAGGATGGGGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973259235 4:48144473-48144495 CAGAAGGAAAAGAAGAATGGAGG + Intronic
973604292 4:52571227-52571249 GAGAAGGAACAGCAGGATGGAGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975374328 4:73626022-73626044 CAGAGGGAACGGGAAGATGTAGG - Intergenic
977805150 4:101288579-101288601 AAGAGGGAACAACGGGAAGGAGG + Intronic
977918582 4:102619995-102620017 CAGAGGGCACAGCACGATGGGGG - Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978400971 4:108330355-108330377 GAGTGGGAAGAGCAGGAAGGAGG - Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979538597 4:121853424-121853446 CAGAGGGAGGAGCAGTATTGAGG - Intronic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
979957693 4:126974886-126974908 AACATGGAACAGCTGGATGGTGG + Intergenic
980085351 4:128384771-128384793 CAGCGGGAAGGGCAGCATGGTGG + Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
981085444 4:140678537-140678559 CAGAGGGAAGATGACGATGGGGG - Intronic
982808474 4:159796157-159796179 GAGAGAGAATTGCAGGATGGTGG - Intergenic
983398456 4:167233724-167233746 CACAGGGGAGAGCAGGGTGGGGG + Intronic
983813101 4:172088806-172088828 CAGAGATAACAGCAGGGTAGGGG + Intronic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
984498782 4:180532490-180532512 CAGAGGCTACTGCATGATGGGGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
985695307 5:1336831-1336853 CTGAGGGAACAGCAGTACAGGGG + Intronic
986180137 5:5385413-5385435 CAGAGGGAACAGCTGGGAAGGGG + Intergenic
986790162 5:11151741-11151763 AAAAGGGAATAGCATGATGGGGG + Intronic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989166769 5:38440157-38440179 CAGAGGGAACTGCAGGACATTGG + Intronic
991937505 5:71816499-71816521 GAGAGGGCACAGCAAGAAGGCGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992034967 5:72764169-72764191 AGGAGGGAAAAGGAGGATGGAGG - Intergenic
992386275 5:76287631-76287653 CAGAGGGAACAGCAGCACTGTGG - Intronic
992625496 5:78632927-78632949 CAAAAGGAACAGCAAGACGGGGG + Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
993761492 5:91801677-91801699 CAGAGTGAAGGGCAGGGTGGGGG + Intergenic
994151721 5:96455657-96455679 CTGAGGGAACGGCAGGACTGAGG - Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996427016 5:123324782-123324804 CAGAGGGAAGGGCAGTAGGGGGG - Intergenic
996939035 5:128981605-128981627 TAGAGTGAGCAGAAGGATGGAGG + Intronic
998901483 5:146860135-146860157 TAAAAGGAAAAGCAGGATGGTGG - Intronic
999692230 5:154157998-154158020 CAGAGAGAACAGCAAGATCTGGG + Intronic
1000235930 5:159360561-159360583 CAGAGGGAAGAGTGGGAGGGAGG + Intergenic
1001306581 5:170578896-170578918 CAGAAGGAATAGCAAGAGGGAGG + Intronic
1001628880 5:173159987-173160009 CATGGGGATCAGCAGGATGATGG + Exonic
1003022620 6:2524324-2524346 CAGAGGGCACTGCAGGAGGAAGG - Intergenic
1003123768 6:3339052-3339074 CAGAGGGAAGAGCAGGGTCGAGG + Intronic
1003567596 6:7233808-7233830 GAGGTGGAACAGCAGGAGGGAGG + Intronic
1004067655 6:12264960-12264982 GAGAGGGAACAGCAAAGTGGAGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1006304661 6:33211802-33211824 CGGAGGCAACAGCAGGAAGCAGG + Exonic
1006673215 6:35742989-35743011 ACGAGGGAACAGCAGCAAGGGGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007287369 6:40757363-40757385 CAGAGAGAGAAGCAGGTTGGTGG + Intergenic
1007790066 6:44303716-44303738 AAGAGAGAACTACAGGATGGGGG + Intronic
1008359235 6:50595029-50595051 AAGAGGGAGAAGCAGGATGTGGG + Intergenic
1008620573 6:53267203-53267225 CAGAGGGGACAGCATTAGGGTGG + Intergenic
1009735754 6:67674356-67674378 CAGAGGGAAAGGCAGCATGTAGG - Intergenic
1010274071 6:73948833-73948855 CAGAGGTAAAAGCATGAAGGAGG - Intergenic
1011088644 6:83570868-83570890 CAGAGGGAAATGTGGGATGGGGG + Intronic
1011806472 6:91078407-91078429 CAGAGGGAACACCTGCATGAAGG + Intergenic
1012901924 6:105016634-105016656 GAGAGGGAGAATCAGGATGGTGG - Intronic
1014086561 6:117352735-117352757 CAGAGAGAACAACAGGACGCAGG + Intronic
1014442674 6:121491559-121491581 AATAGGGAAAAGCAGAATGGTGG + Intergenic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1015551938 6:134420679-134420701 CAGAGGGAAGAGCAAGCTGATGG - Intergenic
1016461911 6:144286469-144286491 CTGAGGGGACAGGAGGAGGGGGG + Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016848001 6:148588030-148588052 AAGGGGGAACAGCAGATTGGTGG - Intergenic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1017600010 6:156070036-156070058 CAAAGAGAACAGCAGGAGCGAGG - Intergenic
1017722938 6:157256849-157256871 CAGTGGGGGCAGCTGGATGGTGG + Intergenic
1017971753 6:159317822-159317844 AAGGGGCAAAAGCAGGATGGAGG + Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1021107196 7:16651564-16651586 CAGAGGAAACTGCTGGCTGGAGG + Intronic
1021768024 7:23968738-23968760 AAAAGGGAAAAGCAGGCTGGAGG - Intergenic
1021952078 7:25785176-25785198 CAGTGGCAACATCAAGATGGTGG - Intergenic
1022370865 7:29770114-29770136 GAGAGGGAAAAGAAGGAGGGAGG - Intergenic
1023694636 7:42832129-42832151 CAGAGTGAATTGTAGGATGGAGG - Intergenic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024231804 7:47368722-47368744 CCGAGGGACCAGCAGTAGGGTGG - Exonic
1024523455 7:50327889-50327911 CACAAAGATCAGCAGGATGGGGG + Intronic
1024843143 7:53610965-53610987 CAGAGGGAAATGCTGGAAGGAGG - Intergenic
1025853858 7:65262215-65262237 CGGAGGGAAAAGGAGCATGGAGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1027744651 7:82057901-82057923 AACATGGAACATCAGGATGGTGG - Intronic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029284482 7:99456411-99456433 CACTGGGAACAGCAGGAAGTGGG - Exonic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1029362638 7:100098462-100098484 AAGAGGGAAGTGCAGGAGGGAGG - Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1029670100 7:102024197-102024219 AAGAGGGCAGAGCTGGATGGAGG - Intronic
1030303130 7:107993864-107993886 CAGCAGGAACAGCAGGCTGCTGG + Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032738355 7:134713391-134713413 CAGAGGGAACTGCATGTTTGGGG - Intergenic
1033226076 7:139563385-139563407 CAGTGGTGACAGCAGGGTGGAGG + Exonic
1034281890 7:149860378-149860400 CAAAGGGAACAAGAAGATGGTGG + Exonic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034319536 7:150167227-150167249 CACAGTGAACAACAGTATGGAGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034934151 7:155187749-155187771 CAGAGGGCACAGCAGGGAAGTGG - Intergenic
1035012585 7:155732763-155732785 CAGAGGGGACAGCTGTGTGGTGG + Intronic
1035371683 7:158383263-158383285 CAGAGGCAAAAGCAGCATGCAGG + Intronic
1036306946 8:7609982-7610004 TAGGGAGAACAGCAGGATAGGGG + Intergenic
1036846716 8:12175262-12175284 AAGAGGGGACACCAGCATGGGGG + Intergenic
1036868082 8:12417581-12417603 AAGAGGGGACACCAGCATGGGGG + Intergenic
1036893153 8:12608976-12608998 TAGGGAGAACAGCAGGATAGGGG - Intergenic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037540872 8:19869683-19869705 AGGAGGGAACTGCAGGAAGGTGG + Intergenic
1037755100 8:21705319-21705341 CAGAGGGGCCAGCAGCATAGAGG + Intronic
1037779160 8:21855988-21856010 CAGAGGGATCACCTGGAGGGAGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038362046 8:26889941-26889963 CAGAGAGCAGAGCAGGATGCAGG + Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038697523 8:29819415-29819437 CAGAGGGGGCAGCAGGCTGATGG - Intergenic
1039514309 8:38119311-38119333 AAGCGCAAACAGCAGGATGGAGG + Exonic
1039800679 8:40951983-40952005 CAGAGGGCACAGCCAGCTGGGGG - Intergenic
1041021596 8:53643716-53643738 CATGAGGTACAGCAGGATGGAGG - Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1042573790 8:70195922-70195944 CAGAAGGAACAGCATTATAGGGG + Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1047037620 8:120956712-120956734 CCGAGGGAACATCAGAGTGGTGG + Intergenic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048911987 8:139144017-139144039 CAGATGGAACTGCATGAGGGAGG - Intergenic
1049025075 8:139982892-139982914 CAGGGGGAGCAGCATGGTGGAGG - Intronic
1049409960 8:142468641-142468663 CAGAGGGAACAGCTGTGTGAAGG - Intronic
1049453398 8:142674976-142674998 CAGAGGGAATAGCAGGCACGGGG - Intronic
1049884303 9:17336-17358 CAGCTGGAACAGCAGGTGGGAGG - Intergenic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1051215810 9:14796141-14796163 CATAGGGAACAGCAGGATATGGG + Intronic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1052993569 9:34537153-34537175 CAGAGAGAACAGCTTCATGGAGG - Intergenic
1053283204 9:36834937-36834959 CAGGTGAAACAGCAGGGTGGGGG - Exonic
1053294186 9:36901262-36901284 CAGAAGGAACAGCATGATAAAGG - Intronic
1055069095 9:72148574-72148596 CAGAAGGAACAGCACGTTAGAGG + Intronic
1055496894 9:76864293-76864315 CAGAGGGGGTAGCAGGAAGGAGG + Intronic
1055739556 9:79371608-79371630 GAGAGTGATTAGCAGGATGGTGG - Intergenic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057293078 9:93819369-93819391 CAGCAGGAACAGCTGGGTGGAGG + Intergenic
1057397270 9:94691288-94691310 CAGAGGCAGGAGCAGGGTGGAGG - Intergenic
1057513958 9:95705097-95705119 CAGAGGGAGCTGCACCATGGAGG + Intergenic
1058328536 9:103728419-103728441 GAGAGGGAACAGGAGGGTGATGG - Intergenic
1058400540 9:104613163-104613185 CAGAAGGAAGAGAAGGATGGAGG + Intergenic
1058965741 9:110036809-110036831 CATAGGGAACAGCAGGTGTGGGG - Intronic
1059434020 9:114265763-114265785 CACAGGGAAAGGCAGGAGGGAGG + Intronic
1060378613 9:123142585-123142607 AAGAGGAAACATCAGGATGAAGG - Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060765705 9:126293848-126293870 AAGAGGGACCAGCGTGATGGAGG + Intergenic
1061212842 9:129203518-129203540 CAGAGGGAACAGCATGAAGGAGG + Intergenic
1061595703 9:131627882-131627904 ACGATGGAACAGGAGGATGGTGG + Intronic
1061778716 9:132983516-132983538 CAGAGGGAAATGCAGGGTGCTGG - Intronic
1061798174 9:133100560-133100582 CATGGGGAACAGAAGGACGGAGG - Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1062123611 9:134847838-134847860 GAGAGGGAACAGCAGGGCAGAGG + Intergenic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062652621 9:137586007-137586029 CCAAGGGACCAGCAGGATAGGGG - Intronic
1203776526 EBV:76070-76092 CATCGGGCGCAGCAGGATGGTGG + Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1186346408 X:8697505-8697527 CAGAGAGAATGGCAGGTTGGAGG + Intronic
1186474601 X:9847534-9847556 CAGAGGGAAAAGGGGGTTGGAGG + Intronic
1187009994 X:15268975-15268997 CAAAGGGAGCAGCAGGGTGAGGG - Intronic
1187479374 X:19641004-19641026 CAGAGCGGACAGCAGCATAGGGG - Intronic
1188063590 X:25630499-25630521 CAGAAGGAACAGCAGAAGAGAGG - Intergenic
1190113212 X:47608622-47608644 GAGAGGGAGCAACAGGAGGGAGG + Intronic
1192009307 X:67250742-67250764 CAGAGGGAACGGGTGGCTGGAGG + Intergenic
1192192630 X:69001280-69001302 CAGAGGGGAGAGCAAGATGTGGG + Intergenic
1192319802 X:70081285-70081307 CTAAGGCAACAGGAGGATGGGGG + Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192968694 X:76207302-76207324 AAAAGGGAAGAGCAAGATGGTGG - Intergenic
1194993586 X:100570414-100570436 CCGTGTGAACAGCAGAATGGGGG - Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196766667 X:119252229-119252251 CAGAGGGAAGAAACGGATGGGGG - Intergenic
1196843571 X:119880689-119880711 CAGAGGGAACAGCATAAGGGTGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197336174 X:125211700-125211722 AAGAGGGGACAGCTGGAGGGAGG - Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1198217623 X:134570271-134570293 CAGAGGGAAAAGAAGGCTGAGGG + Intronic
1198446896 X:136726363-136726385 CACATGGAAGAGCAGTATGGAGG + Intronic
1198666160 X:139025542-139025564 CAGAAGGAACAGAAAGATGTGGG - Intronic
1199051363 X:143240340-143240362 CAGAATGAACAACTGGATGGGGG - Intergenic
1199977592 X:152903595-152903617 CAGAGACAACTGCAGGATGAGGG + Intergenic
1200253107 X:154564278-154564300 CAGAGGGAAGGGGAGGATGGAGG - Intronic
1200264660 X:154640137-154640159 CAGAGGGAAGGGGAGGATGGAGG + Intergenic
1200401502 X:156022820-156022842 CAGCTGGAACAGCAGGTGGGAGG + Intergenic